Antibodies
Anti-GSPT1 Antibody-Oligo Conjugate
SKU: aoc2235
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GSPT1 Antibody-IF1
Antibody Target
- Target
- Eukaryotic peptide chain release factor GTP-binding subunit ERF3A
- UniProt Number
- P15170
- Target Description
- GTPase component of the eRF1-eRF3-GTP ternary complex, a ternary complex that mediates translation termination in response to the termination codons UAA, UAG and UGA. GSPT1/ERF3A mediates ETF1/ERF1 delivery to stop codons: The eRF1-eRF3-GTP complex binds to a stop codon in the ribosomal A-site. GTP hydrolysis by GSPT1/ERF3A induces a conformational change that leads to its dissociation, permitting ETF1/ERF1 to accommodate fully in the A-site. Component of the transient SURF complex which recruits UPF1 to stalled ribosomes in the context of nonsense-mediated decay (NMD) of mRNAs containing premature stop codons. Required for SHFL-mediated translation termination which inhibits programmed ribosomal frameshifting (-1PRF) of mRNA from viruses and cellular genes.
- Molecular Weight
- 56kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC66181
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat