Antibodies
Anti-GSTP1 Antibody-Oligo Conjugate
SKU: aoc2240
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GSTP1 Antibody-IF1
Antibody Target
- Target
- Glutathione S-transferase P
- UniProt Number
- P09211
- Target Description
- Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. Involved in the formation of glutathione conjugates of both prostaglandin A2 (PGA2) and prostaglandin J2 (PGJ2) (PubMed:9084911). Participates in the formation of novel hepoxilin regioisomers (PubMed:21046276). Negatively regulates CDK5 activity via p25/p35 translocation to prevent neurodegeneration..
- Molecular Weight
- 23kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0439
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat