Antibodies
Anti-GSTP1 Antibody-Oligo Conjugate
SKU: aoc2240
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GSTP1 Antibody-IF1
Antibody Target
- Target
- Glutathione S-transferase P
- UniProt Number
- P09211
- Target Description
- Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. Involved in the formation of glutathione conjugates of both prostaglandin A2 (PGA2) and prostaglandin J2 (PGJ2). Participates in the formation of novel hepoxilin regioisomers. Negatively regulates CDK5 activity via p25/p35 translocation to prevent neurodegeneration.
- Molecular Weight
- 23kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0439
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat