Antibodies
Anti-HADHA Antibody-Oligo Conjugate
SKU: aoc2249
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HADHA Antibody-IF1
Antibody Target
- Target
- Trifunctional enzyme subunit alpha, mitochondrial
- UniProt Number
- P40939
- Target Description
- Mitochondrial trifunctional enzyme catalyzes the last three of the four reactions of the mitochondrial beta-oxidation pathway (PubMed:1550553, PubMed:29915090, PubMed:30850536, PubMed:8135828, PubMed:31604922). The mitochondrial beta-oxidation pathway is the major energy-producing process in tissues and is performed through four consecutive reactions breaking down fatty acids into acetyl-CoA (PubMed:29915090). Among the enzymes involved in this pathway, the trifunctional enzyme exhibits specificity for long-chain fatty acids (PubMed:30850536, PubMed:31604922). Mitochondrial trifunctional enzyme is a heterotetrameric complex composed of two proteins, the trifunctional enzyme subunit alpha/HADHA described here carries the 2,3-enoyl-CoA hydratase and the 3-hydroxyacyl-CoA dehydrogenase activities while the trifunctional enzyme subunit beta/HADHB bears the 3-ketoacyl-CoA thiolase activity (PubMed:29915090, PubMed:30850536, PubMed:8135828). Independently of subunit beta, HADHA also exhibits a cardiolipin acyltransferase activity that participates in cardiolipin remodeling; cardiolipin is a major mitochondrial membrane phospholipid (PubMed:23152787, PubMed:31604922). HADHA may act downstream of Tafazzin/TAZ, that remodels monolysocardiolipin (MLCL) to a cardiolipin intermediate, and then HADHA may continue to remodel this species into mature tetralinoleoyl-cardiolipin (PubMed:31604922). Has also been proposed to act directly on MLCL; capable of acylating MLCL using different acyl-CoA substrates, with highest activity for oleoyl-CoA (PubMed:23152787)..
- Molecular Weight
- 83kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC61206
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat