Antibodies
Anti-HADHB Antibody-Oligo Conjugate
SKU: aoc2250
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HADHB Antibody-IF1
Antibody Target
- Target
- Trifunctional enzyme subunit beta, mitochondrial
- UniProt Number
- P55084
- Target Description
- Mitochondrial trifunctional enzyme catalyzes the last three of the four reactions of the mitochondrial beta-oxidation pathway. The mitochondrial beta-oxidation pathway is the major energy-producing process in tissues and is performed through four consecutive reactions breaking down fatty acids into acetyl-CoA. Among the enzymes involved in this pathway, the trifunctional enzyme exhibits specificity for long-chain fatty acids. Mitochondrial trifunctional enzyme is a heterotetrameric complex composed of two proteins, the trifunctional enzyme subunit alpha/HADHA carries the 2,3-enoyl-CoA hydratase and the 3-hydroxyacyl-CoA dehydrogenase activities, while the trifunctional enzyme subunit beta/HADHB described here bears the 3-ketoacyl-CoA thiolase activity.
- Molecular Weight
- 51kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC66029
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat