Antibodies
Anti-HAO1 Antibody-Oligo Conjugate
SKU: aoc2251
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HAO1 Antibody-IF1
Antibody Target
- Target
- 2-Hydroxyacid oxidase 1
- UniProt Number
- Q9UJM8
- Target Description
- Broad substrate specificity (S)-2-hydroxy-acid oxidase that preferentially oxidizes glycolate (PubMed:10777549, PubMed:10978532, PubMed:17669354, PubMed:18215067). The glyoxylate produced by the oxidation of glycolate can then be utilized by alanine-glyoxylate aminotransferase for the peroxisomal synthesis of glycine; this pathway appears to be an important step for the detoxification of glyoxylate which, if allowed to accumulate, may be metabolized to oxalate with formation of kidney stones (PubMed:10978532, PubMed:17669354). Can also catalyze the oxidation of glyoxylate, and long chain hydroxyacids such as 2-hydroxyhexadecanoate and 2-hydroxyoctanoate, albeit with much lower catalytic efficiency (PubMed:10777549, PubMed:17669354, PubMed:18215067). Active in vitro with the artificial electron acceptor 2,6-dichlorophenolindophenol (DCIP), but O2 is believed to be the physiological electron acceptor, leading to the production of H2O2 (PubMed:10777549, PubMed:10978532, PubMed:17669354, PubMed:18215067). Is not active on L-lactate and 2-hydroxybutanoate (PubMed:10777549)..
- Molecular Weight
- 41kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC53722
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse