Antibodies
Anti-HAO1 Antibody-Oligo Conjugate
SKU: aoc2251
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HAO1 Antibody-IF1
Antibody Target
- Target
- 2-Hydroxyacid oxidase 1
- UniProt Number
- Q9UJM8
- Target Description
- Broad substrate specificity (S)-2-hydroxy-acid oxidase that preferentially oxidizes glycolate. The glyoxylate produced by the oxidation of glycolate can then be utilized by alanine-glyoxylate aminotransferase for the peroxisomal synthesis of glycine; this pathway appears to be an important step for the detoxification of glyoxylate which, if allowed to accumulate, may be metabolized to oxalate with formation of kidney stones. Can also catalyze the oxidation of glyoxylate, and long chain hydroxyacids such as 2-hydroxyhexadecanoate and 2-hydroxyoctanoate, albeit with much lower catalytic efficiency. Active in vitro with the artificial electron acceptor 2,6-dichlorophenolindophenol (DCIP), but O2 is believed to be the physiological electron acceptor, leading to the production of H2O2. Is not active on L-lactate and 2-hydroxybutanoate.
- Molecular Weight
- 41kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC53722
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse