Antibodies
Anti-Haptoglobin Antibody-Oligo Conjugate
SKU: aoc2253
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Haptoglobin Antibody-IF1
Antibody Target
- Target
- Haptoglobin
- UniProt Number
- P00738
- Target Description
- As a result of hemolysis, hemoglobin is found to accumulate in the kidney and is secreted in the urine. Haptoglobin captures, and combines with free plasma hemoglobin to allow hepatic recycling of heme iron and to prevent kidney damage. Haptoglobin also acts as an antioxidant, has antibacterial activity, and plays a role in modulating many aspects of the acute phase response. Hemoglobin/haptoglobin complexes are rapidly cleared by the macrophage CD163 scavenger receptor expressed on the surface of liver Kupfer cells through an endocytic lysosomal degradation pathway.; FUNCTION: The uncleaved form of allele alpha-2 (2-2), known as zonulin, plays a role in intestinal permeability, allowing intercellular tight junction disassembly, and controlling the equilibrium between tolerance and immunity to non-self antigens.
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC1298
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat