Antibodies
Anti-HAT1 Antibody-Oligo Conjugate
SKU: aoc2254
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HAT1 Antibody-IF1
Antibody Target
- Target
- Histone acetyltransferase type B catalytic subunit
- UniProt Number
- O14929
- Target Description
- Histone acetyltransferase that plays a role in different biological processes including cell cycle progression, glucose metabolism, histone production or DNA damage repair (PubMed:20953179, PubMed:23653357, PubMed:31278053, PubMed:32081014). Coordinates histone production and acetylation via H4 promoter binding (PubMed:31278053). Acetylates histone H4 at 'Lys-5' (H4K5ac) and 'Lys-12' (H4K12ac) and, to a lesser extent, histone H2A at 'Lys-5' (H2AK5ac) (PubMed:11585814, PubMed:22615379). Drives H4 production by chromatin binding to support chromatin replication and acetylation. Since transcription of H4 genes is tightly coupled to S-phase, plays an important role in S-phase entry and progression (PubMed:31278053). Promotes homologous recombination in DNA repair by facilitating histone turnover and incorporation of acetylated H3.3 at sites of double-strand breaks (PubMed:23653357). In addition, acetylates other substrates such as chromatin-related proteins (PubMed:32081014). Also acetylates RSAD2 which mediates the interaction of ubiquitin ligase UBE4A with RSAD2 leading to RSAD2 ubiquitination and subsequent degradation (PubMed:31812350)..; FUNCTION: (Microbial infection) Contributes to hepatitis B virus (HBV) replication by acetylating histone H4 at the sites of 'Lys-5' and 'Lys-12' on the covalently closed circular DNA (cccDNA) minichromosome leading to its accumulation within the host cell..
- Molecular Weight
- 50 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIHCICCELISA
- Clone
- ARC1002
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat