Antibodies
Anti-HAT1 Antibody-Oligo Conjugate
SKU: aoc2254
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HAT1 Antibody-IF1
Antibody Target
- Target
- Histone acetyltransferase type B catalytic subunit
- UniProt Number
- O14929
- Target Description
- Histone acetyltransferase that plays a role in different biological processes including cell cycle progression, glucose metabolism, histone production or DNA damage repair. Coordinates histone production and acetylation via H4 promoter binding. Acetylates histone H4 at 'Lys-5' (H4K5ac) and 'Lys-12' (H4K12ac) and, to a lesser extent, histone H2A at 'Lys-5' (H2AK5ac). Drives H4 production by chromatin binding to support chromatin replication and acetylation. Since transcription of H4 genes is tightly coupled to S-phase, plays an important role in S-phase entry and progression. Promotes homologous recombination in DNA repair by facilitating histone turnover and incorporation of acetylated H3.3 at sites of double-strand breaks. In addition, acetylates other substrates such as chromatin-related proteins. Also acetylates RSAD2 which mediates the interaction of ubiquitin ligase UBE4A with RSAD2 leading to RSAD2 ubiquitination and subsequent degradation.; FUNCTION: (Microbial infection) Contributes to hepatitis B virus (HBV) replication by acetylating histone H4 at the sites of 'Lys-5' and 'Lys-12' on the covalently closed circular DNA (cccDNA) minichromosome leading to its accumulation within the host cell.
- Molecular Weight
- 50 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIHCICCELISA
- Clone
- ARC1002
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat