Antibodies
Anti-HCG beta Antibody-Oligo Conjugate (ARC64338)
SKU: aoc2259
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HCG beta Antibody (ARC64338)-IF1
Antibody Target
- Target
- Choriogonadotropin subunit beta 3
- UniProt Number
- P0DN86
- Target Description
- Beta subunit of the human chorionic gonadotropin (hCG). hCG is a complex glycoprotein composed of two glycosylated subunits alpha and beta which are non-covalently associated. The alpha subunit is identical to those in the pituitary gonadotropin hormones (LH, FSH and TSH). The beta subunits are distinct in each of the hormones and confer receptor and biological specificity. Has an essential role in pregnancy and maternal adaptation. Stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy.
- Molecular Weight
- 18kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- ELISAWBIHC
- Clone
- ARC64338
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human