AntibodiesNeuroMab
Anti-HCN1 Antibody-Oligo Conjugate
SKU: aoc16
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HCN1 Antibody-IF1
Antibody Target
- Target
- HCN1
- UniProt Number
- O60741
- Target Description
- HCN1 is a member of the hyperpolarization-activated cyclic nucleotide gated channel family, also known as pacemaker channels. This family has a role in rhythmic activity of the heart and firing neurons. HCN channels are made up of four subunits, HCN1-4 and can be formed in multiple combinations. HCN1 is found in the hippocampus, neocortex, and cerebellar cortex of brain. Alterations in this protein have been implicated in the disease early infantile epileptic encephalopathy.
- Molecular Weight
- 100 kDa
- Synonyms
- Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 1
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPEM
- Specificity
- No cross-reactivity against HCN2
- Clone
- N70/28
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 778-910 (cytoplasmic C-terminus) of rat HCN1 (accession number Q9JKB0); Mouse: 96% identity (128/133 amino acids identical) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- GerbilHumanMonkey (Non-Human Primate)MouseRat