AntibodiesNeuroMab
Anti-HCN4 Antibody-Oligo Conjugate
SKU: aoc13
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HCN4 Antibody-IF1
Antibody Target
- Target
- HCN4
- UniProt Number
- Q9Y3Q4
- Target Description
- HCN4 is a member of the hyperpolarization-activated cyclic nucleotide gated channel family, also known as pacemaker channels. This family has a role in rhythmic activity of the heart and firing neurons. HCN channels are made up of four subunits, HCN1-4 and can be formed in multiple combinations. HCN4 is found in the cell membrane as a multi pass membrane protein in the sino-atrial node of the heart. This protein is highly expressed in neurons in the thalamus and other brain regions and testis. Mutations in HCN4 have been found in several types of sinus bradycardia.
- Molecular Weight
- 130 kDa
- Synonyms
- Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 4
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICC
- Specificity
- No cross-reactivity against other HCN’s
- Clone
- N114/10
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 1019-1108 (cytoplasmic C-terminus) of rat HCN4 (accession number Q9JKA7) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- GerbilHumanMousePigRat