Antibodies

Anti-HDAC3 Antibody-Oligo Conjugate

SKU: aoc2267

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Proximity Ligation Assay Oligossee protocol

PLA1 Oligo Details

5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'

View Paper

An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.

Anti-HDAC3 Antibody-PLA1

Antibody Target

Target
Histone deacetylase 3
UniProt Number
O15379
Target Description
Histone deacetylase that catalyzes the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4), and some other non-histone substrates. Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes, such as N-Cor repressor complex, which activate the histone deacetylase activity. Participates in the BCL6 transcriptional repressor activity by deacetylating the H3 'Lys-27' (H3K27) on enhancer elements, antagonizing EP300 acetyltransferase activity and repressing proximal gene expression. Acts as a molecular chaperone for shuttling phosphorylated NR2C1 to PML bodies for sumoylation. Contributes, together with XBP1 isoform 1, to the activation of NFE2L2-mediated HMOX1 transcription factor gene expression in a PI(3)K/mTORC2/Akt-dependent signaling pathway leading to endothelial cell (EC) survival under disturbed flow/oxidative stress. Regulates both the transcriptional activation and repression phases of the circadian clock in a deacetylase activity-independent manner. During the activation phase, promotes the accumulation of ubiquitinated BMAL1 at the E-boxes and during the repression phase, blocks FBXL3-mediated CRY1/2 ubiquitination and promotes the interaction of CRY1 and BMAL1. The NCOR1-HDAC3 complex regulates the circadian expression of the core clock gene BMAL1 and the genes involved in lipid metabolism in the liver. Also functions as a deacetylase for non-histone targets, such as KAT5, MEF2D, MAPK14, RARA and STAT3. Serves as a corepressor of RARA, mediating its deacetylation and repression, leading to inhibition of RARE DNA element binding. In association with RARA, plays a role in the repression of microRNA-10a and thereby in the inflammatory response. In addition to protein deacetylase activity, also acts as a protein-lysine deacylase by recognizing other acyl groups: catalyzes removal of (2E)-butenoyl (crotonyl), lactoyl (lactyl) and 2-hydroxyisobutanoyl (2-hydroxyisobutyryl) acyl groups from lysine residues, leading to protein decrotonylation, delactylation and de-2-hydroxyisobutyrylation, respectively. Catalyzes decrotonylation of MAPRE1/EB1. Mediates delactylation NBN/NBS1, thereby inhibiting DNA double-strand breaks (DSBs) via homologous recombination (HR).
Molecular Weight
49kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIPELISA
Clone
ARC0016
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat