Antibodies
Anti-HDAC3 Antibody-Oligo Conjugate
SKU: aoc2267
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-HDAC3 Antibody-PLA1
Antibody Target
- Target
- Histone deacetylase 3
- UniProt Number
- O15379
- Target Description
- Histone deacetylase that catalyzes the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4), and some other non-histone substrates (PubMed:21030595, PubMed:21444723, PubMed:23911289, PubMed:25301942, PubMed:28167758, PubMed:28497810, PubMed:32404892, PubMed:22230954). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events (PubMed:23911289). Histone deacetylases act via the formation of large multiprotein complexes, such as N-Cor repressor complex, which activate the histone deacetylase activity (PubMed:23911289, PubMed:22230954). Participates in the BCL6 transcriptional repressor activity by deacetylating the H3 'Lys-27' (H3K27) on enhancer elements, antagonizing EP300 acetyltransferase activity and repressing proximal gene expression (PubMed:23911289). Acts as a molecular chaperone for shuttling phosphorylated NR2C1 to PML bodies for sumoylation (By similarity). Contributes, together with XBP1 isoform 1, to the activation of NFE2L2-mediated HMOX1 transcription factor gene expression in a PI(3)K/mTORC2/Akt-dependent signaling pathway leading to endothelial cell (EC) survival under disturbed flow/oxidative stress (PubMed:25190803). Regulates both the transcriptional activation and repression phases of the circadian clock in a deacetylase activity-independent manner (By similarity). During the activation phase, promotes the accumulation of ubiquitinated BMAL1 at the E-boxes and during the repression phase, blocks FBXL3-mediated CRY1/2 ubiquitination and promotes the interaction of CRY1 and BMAL1 (By similarity). The NCOR1-HDAC3 complex regulates the circadian expression of the core clock gene BMAL1 and the genes involved in lipid metabolism in the liver (By similarity). Also functions as a deacetylase for non-histone targets, such as KAT5, MEF2D, MAPK14, RARA and STAT3 (PubMed:15653507, PubMed:21030595, PubMed:21444723, PubMed:25301942, PubMed:28167758). Serves as a corepressor of RARA, mediating its deacetylation and repression, leading to inhibition of RARE DNA element binding (PubMed:28167758). In association with RARA, plays a role in the repression of microRNA-10a and thereby in the inflammatory response (PubMed:28167758). In addition to protein deacetylase activity, also acts as a protein-lysine deacylase by recognizing other acyl groups: catalyzes removal of (2E)-butenoyl (crotonyl), lactoyl (lactyl) and 2-hydroxyisobutanoyl (2-hydroxyisobutyryl) acyl groups from lysine residues, leading to protein decrotonylation, delactylation and de-2-hydroxyisobutyrylation, respectively (PubMed:28497810, PubMed:29192674, PubMed:34608293, PubMed:35044827). Catalyzes decrotonylation of MAPRE1/EB1 (PubMed:34608293). Mediates delactylation NBN/NBS1, thereby inhibiting DNA double-strand breaks (DSBs) via homologous recombination (HR) (PubMed:38961290)..
- Molecular Weight
- 49kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC0016
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat