Antibodies

Anti-HDAC6 Antibody-Oligo Conjugate

SKU: aoc2269

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-HDAC6 Antibody-IF1

Antibody Target

Target
Protein deacetylase HDAC6
UniProt Number
Q9UBN7
Target Description
Deacetylates a wide range of non-histone substrates (PubMed:12024216, PubMed:18606987, PubMed:20308065, PubMed:24882211, PubMed:26246421, PubMed:30538141, PubMed:31857589, PubMed:30770470, PubMed:38534334, PubMed:39567688). Plays a central role in microtubule-dependent cell motility by mediating deacetylation of tubulin (PubMed:12024216, PubMed:20308065, PubMed:26246421). Required for cilia disassembly via deacetylation of alpha-tubulin (PubMed:17604723, PubMed:26246421). Alpha-tubulin deacetylation results in destabilization of dynamic microtubules (By similarity). Promotes deacetylation of CTTN, leading to actin polymerization, promotion of autophagosome-lysosome fusion and completion of autophagy (PubMed:30538141). Deacetylates SQSTM1 (PubMed:31857589). Deacetylates peroxiredoxins PRDX1 and PRDX2, decreasing their reducing activity (PubMed:18606987). Deacetylates antiviral protein RIGI in the presence of viral mRNAs which is required for viral RNA detection by RIGI (By similarity). Sequentially deacetylates and polyubiquitinates DNA mismatch repair protein MSH2 which leads to MSH2 degradation, reducing cellular sensitivity to DNA-damaging agents and decreasing cellular DNA mismatch repair activities (PubMed:24882211). Deacetylates DNA mismatch repair protein MLH1 which prevents recruitment of the MutL alpha complex (formed by the MLH1-PMS2 heterodimer) to the MutS alpha complex (formed by the MSH2-MSH6 heterodimer), leading to tolerance of DNA damage (PubMed:30770470). Deacetylates RHOT1/MIRO1 which blocks mitochondrial transport and mediates axon growth inhibition (By similarity). Deacetylates transcription factor SP1 which leads to increased expression of ENG, positively regulating angiogenesis (PubMed:38534334). Deacetylates KHDRBS1/SAM68 which regulates alternative splicing by inhibiting the inclusion of CD44 alternate exons (PubMed:26080397). Acts as a valine sensor by binding to valine through the primate-specific SE14 repeat region (PubMed:39567688). In valine deprivation conditions, translocates from the cytoplasm to the nucleus where it deacetylates TET2 which promotes TET2-dependent DNA demethylation, leading to DNA damage (PubMed:39567688). Promotes odontoblast differentiation following IPO7-mediated nuclear import and subsequent repression of RUNX2 expression (By similarity). In addition to its protein deacetylase activity, plays a key role in the degradation of misfolded proteins: when misfolded proteins are too abundant to be degraded by the chaperone refolding system and the ubiquitin-proteasome, mediates the transport of misfolded proteins to a cytoplasmic juxtanuclear structure called aggresome (PubMed:17846173). Probably acts as an adapter that recognizes polyubiquitinated misfolded proteins and targets them to the aggresome, facilitating their clearance by autophagy (PubMed:17846173). Involved in the MTA1-mediated epigenetic regulation of ESR1 expression in breast cancer (PubMed:24413532)..; FUNCTION: (Microbial infection) Deacetylates the SARS-CoV-2 N protein which promotes association of the viral N protein with human G3BP1, leading to disruption of cellular stress granule formation and facilitating viral replication..
Molecular Weight
131kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCIPELISA
Clone
ARC0805
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
Human