Antibodies
Anti-HDAC8 Antibody-Oligo Conjugate
SKU: aoc2270
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HDAC8 Antibody-IF1
Antibody Target
- Target
- Histone deacetylase 8
- UniProt Number
- Q9BY41
- Target Description
- Histone deacetylase that catalyzes the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4) (PubMed:10748112, PubMed:10922473, PubMed:10926844, PubMed:14701748, PubMed:28497810). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events (PubMed:10748112, PubMed:10922473, PubMed:10926844, PubMed:14701748). Histone deacetylases act via the formation of large multiprotein complexes (PubMed:10748112, PubMed:10922473, PubMed:10926844, PubMed:14701748). Also involved in the deacetylation of cohesin complex protein SMC3 regulating release of cohesin complexes from chromatin (PubMed:22885700). May play a role in smooth muscle cell contractility (PubMed:15772115). In addition to protein deacetylase activity, also has protein-lysine deacylase activity: acts as a protein decrotonylase by mediating decrotonylation ((2E)-butenoyl) of histones (PubMed:28497810)..
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCICCIPELISA
- Clone
- ARC1331
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat