Antibodies
Anti-HDAC8 Antibody-Oligo Conjugate
SKU: aoc2270
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HDAC8 Antibody-IF1
Antibody Target
- Target
- Histone deacetylase 8
- UniProt Number
- Q9BY41
- Target Description
- Histone deacetylase that catalyzes the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. Also involved in the deacetylation of cohesin complex protein SMC3 regulating release of cohesin complexes from chromatin. May play a role in smooth muscle cell contractility. In addition to protein deacetylase activity, also has protein-lysine deacylase activity: acts as a protein decrotonylase by mediating decrotonylation ((2E)-butenoyl) of histones.
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCICCIPELISA
- Clone
- ARC1331
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat