Antibodies
Anti-HDAC9 Antibody-Oligo Conjugate
SKU: aoc2271
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HDAC9 Antibody-IF1
Antibody Target
- Target
- Histone deacetylase 9
- UniProt Number
- Q9UKV0
- Target Description
- Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Represses MEF2-dependent transcription..; FUNCTION: Isoform 3 lacks active site residues and therefore is catalytically inactive. Represses MEF2-dependent transcription by recruiting HDAC1 and/or HDAC3. Seems to inhibit skeletal myogenesis and to be involved in heart development. Protects neurons from apoptosis, both by inhibiting JUN phosphorylation by MAPK10 and by repressing JUN transcription via HDAC1 recruitment to JUN promoter.
- Molecular Weight
- 111kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC0735
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat