Antibodies
Anti-HES1 Antibody-Oligo Conjugate
SKU: aoc2280
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HES1 Antibody-IF1
Antibody Target
- Target
- Transcription factor HES-1
- UniProt Number
- Q14469
- Target Description
- Transcriptional repressor of genes that require a bHLH protein for their transcription. May act as a negative regulator of myogenesis by inhibiting the functions of MYOD1 and ASH1. Binds DNA on N-box motifs: 5'-CACNAG-3' with high affinity and on E-box motifs: 5'-CANNTG-3' with low affinity. May play a role in a functional FA core complex response to DNA cross-link damage, being required for the stability and nuclear localization of FA core complex proteins, as well as for FANCD2 monoubiquitination in response to DNA damage.
- Molecular Weight
- 30kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC0513
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat