Antibodies
Anti-HEXA Antibody-Oligo Conjugate
SKU: aoc2283
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HEXA Antibody-IF1
Antibody Target
- Target
- Beta-hexosaminidase subunit alpha
- UniProt Number
- P06865
- Target Description
- Hydrolyzes the non-reducing end N-acetyl-D-hexosamine and/or sulfated N-acetyl-D-hexosamine of glycoconjugates, such as the oligosaccharide moieties from proteins and neutral glycolipids, or from certain mucopolysaccharides. The isozyme S is as active as the isozyme A on the anionic bis-sulfated glycans, the chondroitin-6-sulfate trisaccharide (C6S-3), and the dermatan sulfate pentasaccharide, and the sulfated glycosphingolipid SM2. The isozyme B does not hydrolyze each of these substrates, however hydrolyzes efficiently neutral oligosaccharide. Only the isozyme A is responsible for the degradation of GM2 gangliosides in the presence of GM2A.
- Molecular Weight
- 61kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC59872
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat