Antibodies
Anti-Hexokinase 1 Antibody-Oligo Conjugate
SKU: aoc2285
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Hexokinase 1 Antibody-IF1
Antibody Target
- Target
- Hexokinase-1
- UniProt Number
- P19367
- Target Description
- Catalyzes the phosphorylation of various hexoses, such as D-glucose, D-glucosamine, D-fructose, D-mannose and 2-deoxy-D-glucose, to hexose 6-phosphate (D-glucose 6-phosphate, D-glucosamine 6-phosphate, D-fructose 6-phosphate, D-mannose 6-phosphate and 2-deoxy-D-glucose 6-phosphate, respectively). Does not phosphorylate N-acetyl-D-glucosamine. Mediates the initial step of glycolysis by catalyzing phosphorylation of D-glucose to D-glucose 6-phosphate. Involved in innate immunity and inflammation by acting as a pattern recognition receptor for bacterial peptidoglycan. When released in the cytosol, N-acetyl-D-glucosamine component of bacterial peptidoglycan inhibits the hexokinase activity of HK1 and causes its dissociation from mitochondrial outer membrane, thereby activating the NLRP3 inflammasome.
- Molecular Weight
- 102kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPICCIF-PIHCELISA
- Clone
- ARC0256
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat