Antibodies
Anti-HINT1 Antibody-Oligo Conjugate
SKU: aoc2292
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HINT1 Antibody-IF1
Antibody Target
- Target
- Adenosine 5'-monophosphoramidase HINT1
- UniProt Number
- P49773
- Target Description
- Exhibits adenosine 5'-monophosphoramidase activity, hydrolyzing purine nucleotide phosphoramidates with a single phosphate group such as adenosine 5'monophosphoramidate (AMP-NH2) to yield AMP and NH2 (PubMed:15703176, PubMed:16835243, PubMed:17217311, PubMed:17337452, PubMed:22329685, PubMed:23614568, PubMed:28691797, PubMed:29787766, PubMed:31990367). Hydrolyzes adenosine 5'monophosphomorpholidate (AMP-morpholidate) and guanosine 5'monophosphomorpholidate (GMP-morpholidate) (PubMed:15703176, PubMed:16835243). Hydrolyzes lysyl-AMP (AMP-N-epsilon-(N-alpha-acetyl lysine methyl ester)) generated by lysine tRNA ligase, as well as Met-AMP, His-AMP and Asp-AMP, lysyl-GMP (GMP-N-epsilon-(N-alpha-acetyl lysine methyl ester)) and AMP-N-alanine methyl ester (PubMed:15703176, PubMed:17337452, PubMed:22329685). Hydrolyzes 3-indolepropionic acyl-adenylate, tryptamine adenosine phosphoramidate monoester and other fluorogenic purine nucleoside tryptamine phosphoramidates in vitro (PubMed:17217311, PubMed:17337452, PubMed:23614568, PubMed:28691797, PubMed:29787766, PubMed:31990367). Can also convert adenosine 5'-O-phosphorothioate and guanosine 5'-O-phosphorothioate to the corresponding nucleoside 5'-O-phosphates with concomitant release of hydrogen sulfide (PubMed:30772266). In addition, functions as scaffolding protein that modulates transcriptional activation by the LEF1/TCF1-CTNNB1 complex and by the complex formed with MITF and CTNNB1 (PubMed:16014379, PubMed:22647378). Modulates p53/TP53 levels and p53/TP53-mediated apoptosis (PubMed:16835243). Modulates proteasomal degradation of target proteins by the SCF (SKP2-CUL1-F-box protein) E3 ubiquitin-protein ligase complex (PubMed:19112177). Also exhibits SUMO-specific isopeptidase activity, deconjugating SUMO1 from RGS17 (PubMed:31088288). Deconjugates SUMO1 from RANGAP1 (By similarity)..
- Molecular Weight
- 14kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC2853
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat