Antibodies
Anti-HIPK2 Antibody-Oligo Conjugate
SKU: aoc2293
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HIPK2 Antibody-IF1
Antibody Target
- Target
- Homeodomain-interacting protein kinase 2
- UniProt Number
- Q9H2X6
- Target Description
- Serine/threonine-protein kinase involved in transcription regulation, p53/TP53-mediated cellular apoptosis and regulation of the cell cycle. Acts as a corepressor of several transcription factors, including SMAD1 and POU4F1/Brn3a and probably NK homeodomain transcription factors. Phosphorylates PDX1, ATF1, PML, p53/TP53, CREB1, CTBP1, CBX4, RUNX1, EP300, CTNNB1, HMGA1, ZBTB4 and DAZAP2. Inhibits cell growth and promotes apoptosis through the activation of p53/TP53 both at the transcription level and at the protein level (by phosphorylation and indirect acetylation). The phosphorylation of p53/TP53 may be mediated by a p53/TP53-HIPK2-AXIN1 complex. Involved in the response to hypoxia by acting as a transcriptional co-suppressor of HIF1A. Mediates transcriptional activation of TP73. In response to TGFB, cooperates with DAXX to activate JNK. Negative regulator through phosphorylation and subsequent proteasomal degradation of CTNNB1 and the antiapoptotic factor CTBP1. In the Wnt/beta-catenin signaling pathway acts as an intermediate kinase between MAP3K7/TAK1 and NLK to promote the proteasomal degradation of MYB. Phosphorylates CBX4 upon DNA damage and promotes its E3 SUMO-protein ligase activity. Activates CREB1 and ATF1 transcription factors by phosphorylation in response to genotoxic stress. In response to DNA damage, stabilizes PML by phosphorylation. PML, HIPK2 and FBXO3 may act synergically to activate p53/TP53-dependent transactivation. Promotes angiogenesis, and is involved in erythroid differentiation, especially during fetal liver erythropoiesis. Phosphorylation of RUNX1 and EP300 stimulates EP300 transcription regulation activity. Triggers ZBTB4 protein degradation in response to DNA damage. In response to DNA damage, phosphorylates DAZAP2 which localizes DAZAP2 to the nucleus, reduces interaction of DAZAP2 with HIPK2 and prevents DAZAP2-dependent ubiquitination of HIPK2 by E3 ubiquitin-protein ligase SIAH1 and subsequent proteasomal degradation (PubMed:33591310). Modulates HMGA1 DNA-binding affinity. In response to high glucose, triggers phosphorylation-mediated subnuclear localization shifting of PDX1. Involved in the regulation of eye size, lens formation and retinal lamination during late embryogenesis..
- Molecular Weight
- 101KDa/128KDa/131kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PELISA
- Clone
- ARC1631
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse