Antibodies
Anti-Histone H2A.Z Antibody-Oligo Conjugate
SKU: aoc2300
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-Histone H2A.Z Antibody-PLA1
Antibody Target
- Target
- Histone H2A.Z
- UniProt Number
- P0C0S5
- Target Description
- Variant histone H2A which replaces conventional H2A in a subset of nucleosomes. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling. May be involved in the formation of constitutive heterochromatin. May be required for chromosome segregation during cell division..
- Molecular Weight
- 14kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISAChIP
- Clone
- ARC1048
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRatOther (Wide Range Predicted)