Antibodies
Anti-Histone H2B Antibody-Oligo Conjugate
SKU: aoc2301
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Histone H2B Antibody-IF1
Antibody Target
- Target
- Histone H2B type 1-C/E/F/G/I
- UniProt Number
- P62807
- Additional Target Information
- This antibody also binds Histone H2B type 2-E, Uniprot:Q16778.
- Target Description
- Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling.; FUNCTION: Has broad antibacterial activity. May contribute to the formation of the functional antimicrobial barrier of the colonic epithelium, and to the bactericidal activity of amniotic fluid.
- Molecular Weight
- 14 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCChIPELISA
- Clone
- ARC68307
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat