Antibodies
Anti-Histone H2B (testis specific) Antibody-Oligo Conjugate
SKU: aoc2302
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Histone H2B (testis specific) Antibody-IF1
Antibody Target
- Target
- Histone H2B type 1-A
- UniProt Number
- Q96A08
- Target Description
- Variant histone specifically required to direct the transformation of dissociating nucleosomes to protamine in male germ cells. Entirely replaces classical histone H2B prior nucleosome to protamine transition and probably acts as a nucleosome dissociating factor that creates a more dynamic chromatin, facilitating the large-scale exchange of histones. Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling. Also found in fat cells, its function and the presence of post-translational modifications specific to such cells are still unclear.
- Molecular Weight
- 14kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIF-PIHCELISA
- Clone
- ARC63457
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRatOther (Wide Range Predicted)