Antibodies
Anti-HLA-DR Antibody-Oligo Conjugate (ARC0518)
SKU: aoc2311
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HLA-DR Antibody (ARC0518)-IF1
Antibody Target
- Target
- HLA class II histocompatibility antigen, DR alpha chain
- UniProt Number
- P01903
- Target Description
- An alpha chain of antigen-presenting major histocompatibility complex class II (MHCII) molecule. In complex with the beta chain HLA-DRB, displays antigenic peptides on professional antigen presenting cells (APCs) for recognition by alpha-beta T cell receptor (TCR) on HLA-DR-restricted CD4-positive T cells. This guides antigen-specific T-helper effector functions, both antibody-mediated immune response and macrophage activation, to ultimately eliminate the infectious agents and transformed cells. Typically presents extracellular peptide antigens of 10 to 30 amino acids that arise from proteolysis of endocytosed antigens in lysosomes. In the tumor microenvironment, presents antigenic peptides that are primarily generated in tumor-resident APCs likely via phagocytosis of apoptotic tumor cells or macropinocytosis of secreted tumor proteins. Presents peptides derived from intracellular proteins that are trapped in autolysosomes after macroautophagy, a mechanism especially relevant for T cell selection in the thymus and central immune tolerance. The selection of the immunodominant epitopes follows two processing modes: 'bind first, cut/trim later' for pathogen-derived antigenic peptides and 'cut first, bind later' for autoantigens/self-peptides. The anchor residue at position 1 of the peptide N-terminus, usually a large hydrophobic residue, is essential for high affinity interaction with MHCII molecules.
- Molecular Weight
- 29kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0518
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human