Antibodies
Anti-HLA-DR Antibody-Oligo Conjugate (ARC0518)
SKU: aoc2311
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HLA-DR Antibody (ARC0518)-IF1
Antibody Target
- Target
- HLA class II histocompatibility antigen, DR alpha chain
- UniProt Number
- P01903
- Target Description
- An alpha chain of antigen-presenting major histocompatibility complex class II (MHCII) molecule. In complex with the beta chain HLA-DRB, displays antigenic peptides on professional antigen presenting cells (APCs) for recognition by alpha-beta T cell receptor (TCR) on HLA-DR-restricted CD4-positive T cells. This guides antigen-specific T-helper effector functions, both antibody-mediated immune response and macrophage activation, to ultimately eliminate the infectious agents and transformed cells (PubMed:15265931, PubMed:15322540, PubMed:17334368, PubMed:22327072, PubMed:24190431, PubMed:27591323, PubMed:29884618, PubMed:31495665, PubMed:8145819, PubMed:9075930). Typically presents extracellular peptide antigens of 10 to 30 amino acids that arise from proteolysis of endocytosed antigens in lysosomes (PubMed:8145819). In the tumor microenvironment, presents antigenic peptides that are primarily generated in tumor-resident APCs likely via phagocytosis of apoptotic tumor cells or macropinocytosis of secreted tumor proteins (PubMed:31495665). Presents peptides derived from intracellular proteins that are trapped in autolysosomes after macroautophagy, a mechanism especially relevant for T cell selection in the thymus and central immune tolerance (PubMed:17182262, PubMed:23783831). The selection of the immunodominant epitopes follows two processing modes: 'bind first, cut/trim later' for pathogen-derived antigenic peptides and 'cut first, bind later' for autoantigens/self-peptides (PubMed:25413013). The anchor residue at position 1 of the peptide N-terminus, usually a large hydrophobic residue, is essential for high affinity interaction with MHCII molecules (PubMed:8145819)..
- Molecular Weight
- 29kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0518
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human