Antibodies
Anti-HLA-DRB1 Antibody-Oligo Conjugate
SKU: aoc2312
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HLA-DRB1 Antibody-IF1
Antibody Target
- Target
- HLA class II histocompatibility antigen, DRB1 beta chain
- UniProt Number
- P01911
- Target Description
- A beta chain of antigen-presenting major histocompatibility complex class II (MHCII) molecule. In complex with the alpha chain HLA-DRA, displays antigenic peptides on professional antigen presenting cells (APCs) for recognition by alpha-beta T cell receptor (TCR) on HLA-DRB1-restricted CD4-positive T cells. This guides antigen-specific T-helper effector functions, both antibody-mediated immune response and macrophage activation, to ultimately eliminate the infectious agents and transformed cells (PubMed:15265931, PubMed:16148104, PubMed:22327072, PubMed:27591323, PubMed:29884618, PubMed:31495665, PubMed:8642306). Typically presents extracellular peptide antigens of 10 to 30 amino acids that arise from proteolysis of endocytosed antigens in lysosomes (PubMed:8145819). In the tumor microenvironment, presents antigenic peptides that are primarily generated in tumor-resident APCs likely via phagocytosis of apoptotic tumor cells or macropinocytosis of secreted tumor proteins (PubMed:31495665). Presents peptides derived from intracellular proteins that are trapped in autolysosomes after macroautophagy, a mechanism especially relevant for T cell selection in the thymus and central immune tolerance (PubMed:17182262, PubMed:23783831). The selection of the immunodominant epitopes follows two processing modes: 'bind first, cut/trim later' for pathogen-derived antigenic peptides and 'cut first, bind later' for autoantigens/self-peptides (PubMed:25413013). The anchor residue at position 1 of the peptide N-terminus, usually a large hydrophobic residue, is essential for high affinity interaction with MHCII molecules (PubMed:8145819)..; FUNCTION: Allele DRB1*01:01: Displays an immunodominant epitope derived from Bacillus anthracis pagA/protective antigen, PA (KLPLYISNPNYKVNVYAVT), to both naive and PA-specific memory CD4-positive T cells (PubMed:22327072). Presents immunodominant HIV-1 gag peptide (FRDYVDRFYKTLRAEQASQE) on infected dendritic cells for recognition by TRAV24-TRBV2 TCR on CD4-positive T cells and controls viral load (PubMed:29884618). May present to T-helper 1 cells several HRV-16 epitopes derived from capsid proteins VP1 (PRFSLPFLSIASAYYMFYDG) and VP2 (PHQFINLRSNNSATLIVPYV), contributing to viral clearance (PubMed:27591323). Displays commonly recognized peptides derived from IAV external protein HA (PKYVKQNTLKLAT and SNGNFIAPEYAYKIVK) and from internal proteins M, NP and PB1, with M-derived epitope (GLIYNRMGAVTTEV) being the most immunogenic (PubMed:25413013, PubMed:32668259, PubMed:8145819, PubMed:9075930). Presents a self-peptide derived from COL4A3 (GWISLWKGFSF) to TCR (TRAV14 biased) on CD4-positive, FOXP3-positive regulatory T cells and mediates immune tolerance to self (PubMed:28467828). May present peptides derived from oncofetal trophoblast glycoprotein TPBG 5T4, known to be recognized by both T-helper 1 and regulatory T cells (PubMed:31619516). Displays with low affinity a self-peptide derived from MBP (VHFFKNIVTPRTP) (PubMed:9075930)..; FUNCTION: Allele DRB1*03:01: May present to T-helper 1 cells an HRV-16 epitope derived from capsid protein VP2 (NEKQPSDDNWLNFDGTLLGN), contributing to viral clearance (PubMed:27591323). Displays self-peptides derived from retinal SAG (NRERRGIALDGKIKHE) and thyroid TG (LSSVVVDPSIRHFDV) (PubMed:25413013). Presents viral epitopes derived from HHV-6B gH/U48 and U85 antigens to polyfunctional CD4-positive T cells with cytotoxic activity implicated in control of HHV-6B infection (PubMed:31020640). Presents several immunogenic epitopes derived from C.tetani neurotoxin tetX, playing a role in immune recognition and long-term protection (PubMed:19830726)..; FUNCTION: Allele DRB1*04:01: Presents an immunodominant bacterial epitope derived from M.tuberculosis esxB/culture filtrate antigen CFP-10 (EISTNIRQAGVQYSR), eliciting CD4-positive T cell effector functions such as IFNG production and cytotoxic activity (PubMed:15265931). May present to T-helper 1 cells an HRV-16 epitope derived from capsid protein VP2 (NEKQPSDDNWLNFDGTLLGN), contributing to viral clearance (PubMed:27591323). Presents tumor epitopes derived from melanoma-associated TYR antigen (QNILLSNAPLGPQFP and DYSYLQDSDPDSFQD), triggering CD4-positive T cell effector functions such as GMCSF production (PubMed:8642306). Displays preferentially citrullinated self-peptides derived from VIM (GVYATR/citSSAVR and SAVRAR/citSSVPGVR) and ACAN (VVLLVATEGR/ CitVRVNSAYQDK) (PubMed:24190431). Displays self-peptides derived from COL2A1 (PubMed:9354468)..; FUNCTION: Allele DRB1*04:02: Displays native or citrullinated self-peptides derived from VIM..; FUNCTION: Allele DRB1*04:04: May present to T-helper 1 cells several HRV-16 epitopes derived from capsid proteins VP1 (HIVMQYMYVPPGAPIPTTRN) and VP2 (RGDSTITSQDVANAVVGYGV), contributing to viral clearance (PubMed:27591323). Displays preferentially citrullinated self-peptides derived from VIM (SAVRAR/citSSVPGVR) (PubMed:24190431)..; FUNCTION: Allele DRB1*04:05: May present to T-helper 1 cells an immunogenic epitope derived from tumor-associated antigen WT1 (KRYFKLSHLQMHSRKH), likely providing for effective antitumor immunity in a wide range of solid and hematological malignancies..; FUNCTION: Allele DRB1*05:01: Presents an immunodominant HIV-1 gag peptide (FRDYVDRFYKTLRAEQASQE) on infected dendritic cells for recognition by TRAV24-TRBV2 TCR on CD4-positive T cells and controls viral load..; FUNCTION: Allele DRB1*07:01: Upon EBV infection, presents latent antigen EBNA2 peptide (PRSPTVFYNIPPMPLPPSQL) to CD4-positive T cells, driving oligoclonal expansion and selection of a dominant virus-specific memory T cell subset with cytotoxic potential to directly eliminate virus-infected B cells (PubMed:31308093). May present to T-helper 1 cells several HRV-16 epitopes derived from capsid proteins VP1 (PRFSLPFLSIASAYYMFYDG) and VP2 (VPYVNAVPMDSMVRHNNWSL), contributing to viral clearance (PubMed:27591323). In the context of tumor immunesurveillance, may present to T-helper 1 cells an immunogenic epitope derived from tumor-associated antigen WT1 (MTEYKLVVVGAVGVGKSALTIQLI), likely providing for effective antitumor immunity in a wide range of solid and hematological malignancies (PubMed:22929521). In metastatic epithelial tumors, presents to intratumoral CD4-positive T cells a KRAS neoantigen (MTEYKLVVVGAVGVGKSALTIQLI) carrying G12V hotspot driver mutation and may mediate tumor regression (PubMed:30282837)..; FUNCTION: Allele DRB1*11:01: Displays an immunodominant HIV-1 gag peptide (FRDYVDRFYKTLRAEQASQE) on infected dendritic cells for recognition by TRAV24-TRBV2 TCR on CD4-positive T cells and controls viral load (PubMed:29884618). May present to T-helper 1 cells an HRV-16 epitope derived from capsid protein VP2 (SDRIIQITRGDSTITSQDVA), contributing to viral clearance (PubMed:27591323). Presents several immunogenic epitopes derived from C.tetani neurotoxin tetX, playing a role in immune recognition and longterm protection (PubMed:19830726). In the context of tumor immunesurveillance, may present tumor-derived neoantigens to CD4-positive T cells and trigger anti-tumor helper functions (PubMed:31495665)..; FUNCTION: Allele DRB1*13:01: Presents viral epitopes derived from HHV-6B antigens to polyfunctional CD4-positive T cells implicated in control of HHV-6B infection..; FUNCTION: Allele DRB1*15:01: May present to T-helper 1 cells an HRV-16 epitope derived from capsid protein VP2 (SNNSATLIVPYVNAVPMDSM), contributing to viral clearance (PubMed:27591323). Displays a self-peptide derived from MBP (ENPVVHFFKNIVTPR) (PubMed:25413013, PubMed:9782128). May present to T-helper 1 cells an immunogenic epitope derived from tumor-associated antigen WT1 (KRYFKLSHLQMHSRKH), likely providing for effective antitumor immunity in a wide range of solid and hematological malignancies..; FUNCTION: Allele DRB1*15:02: Displays an immunodominant HIV-1 gag peptide (FRDYVDRFYKTLRAEQASQE) on infected dendritic cells for recognition by TRAV24-TRBV2 TCR on CD4-positive T cells and controls viral load (PubMed:29884618). May present to T-helper 1 cells an immunogenic epitope derived from tumor-associated antigen WT1 (KRYFKLSHLQMHSRKH), likely providing for effective antitumor immunity in a wide range of solid and hematological malignancies (PubMed:19120973)..; FUNCTION: (Microbial infection) Acts as a receptor for Epstein-Barr virus on lymphocytes..
- Molecular Weight
- 30kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2360
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human