Antibodies

Anti-HLA-DRB1 Antibody-Oligo Conjugate

Name: Anti-HLA-DRB1 Antibody-Oligo Conjugate
Brand: AbOliGo
SKU: aoc2312

SKU: aoc2312

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

Consistent conjugation performance
Flexible antibody and oligo pairing
Fast conjugation turn around time
Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

Sequence

AATATGGAATTCGTCCGAGCCCGTCAAG

Reference

View Paper

Notes

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-HLA-DRB1 Antibody-IF1

Antibody Target

Target: HLA class II histocompatibility antigen, DRB1 beta chain
UniProt Number: P01911
Target Description: A beta chain of antigen-presenting major histocompatibility complex class II (MHCII) molecule. In complex with the alpha chain HLA-DRA, displays antigenic peptides on professional antigen presenting cells (APCs) for recognition by alpha-beta T cell receptor (TCR) on HLA-DRB1-restricted CD4-positive T cells. This guides antigen-specific T-helper effector functions, both antibody-mediated immune response and macrophage activation, to ultimately eliminate the infectious agents and transformed cells (PubMed:15265931, PubMed:16148104, PubMed:22327072, PubMed:27591323, PubMed:29884618, PubMed:31495665, PubMed:8642306). Typically presents extracellular peptide antigens of 10 to 30 amino acids that arise from proteolysis of endocytosed antigens in lysosomes (PubMed:8145819). In the tumor microenvironment, presents antigenic peptides that are primarily generated in tumor-resident APCs likely via phagocytosis of apoptotic tumor cells or macropinocytosis of secreted tumor proteins (PubMed:31495665). Presents peptides derived from intracellular proteins that are trapped in autolysosomes after macroautophagy, a mechanism especially relevant for T cell selection in the thymus and central immune tolerance (PubMed:17182262, PubMed:23783831). The selection of the immunodominant epitopes follows two processing modes: 'bind first, cut/trim later' for pathogen-derived antigenic peptides and 'cut first, bind later' for autoantigens/self-peptides (PubMed:25413013). The anchor residue at position 1 of the peptide N-terminus, usually a large hydrophobic residue, is essential for high affinity interaction with MHCII molecules (PubMed:8145819)..; FUNCTION: Allele DRB1*01:01: Displays an immunodominant epitope derived from Bacillus anthracis pagA/protective antigen, PA (KLPLYISNPNYKVNVYAVT), to both naive and PA-specific memory CD4-positive T cells (PubMed:22327072). Presents immunodominant HIV-1 gag peptide (FRDYVDRFYKTLRAEQASQE) on infected dendritic cells for recognition by TRAV24-TRBV2 TCR on CD4-positive T cells and controls viral load (PubMed:29884618). May present to T-helper 1 cells several HRV-16 epitopes derived from capsid proteins VP1 (PRFSLPFLSIASAYYMFYDG) and VP2 (PHQFINLRSNNSATLIVPYV), contributing to viral clearance (PubMed:27591323). Displays commonly recognized peptides derived from IAV external protein HA (PKYVKQNTLKLAT and SNGNFIAPEYAYKIVK) and from internal proteins M, NP and PB1, with M-derived epitope (GLIYNRMGAVTTEV) being the most immunogenic (PubMed:25413013, PubMed:32668259, PubMed:8145819, PubMed:9075930). Presents a self-peptide derived from COL4A3 (GWISLWKGFSF) to TCR (TRAV14 biased) on CD4-positive, FOXP3-positive regulatory T cells and mediates immune tolerance to self (PubMed:28467828). May present peptides derived from oncofetal trophoblast glycoprotein TPBG 5T4, known to be recognized by both T-helper 1 and regulatory T cells (PubMed:31619516). Displays with low affinity a self-peptide derived from MBP (VHFFKNIVTPRTP) (PubMed:9075930)..; FUNCTION: Allele DRB1*03:01: May present to T-helper 1 cells an HRV-16 epitope derived from capsid protein VP2 (NEKQPSDDNWLNFDGTLLGN), contributing to viral clearance (PubMed:27591323). Displays self-peptides derived from retinal SAG (NRERRGIALDGKIKHE) and thyroid TG (LSSVVVDPSIRHFDV) (PubMed:25413013). Presents viral epitopes derived from HHV-6B gH/U48 and U85 antigens to polyfunctional CD4-positive T cells with cytotoxic activity implicated in control of HHV-6B infection (PubMed:31020640). Presents several immunogenic epitopes derived from C.tetani neurotoxin tetX, playing a role in immune recognition and long-term protection (PubMed:19830726)..; FUNCTION: Allele DRB1*04:01: Presents an immunodominant bacterial epitope derived from M.tuberculosis esxB/culture filtrate antigen CFP-10 (EISTNIRQAGVQYSR), eliciting CD4-positive T cell effector functions such as IFNG production and cytotoxic activity (PubMed:15265931). May present to T-helper 1 cells an HRV-16 epitope derived from capsid protein VP2 (NEKQPSDDNWLNFDGTLLGN), contributing to viral clearance (PubMed:27591323). Presents tumor epitopes derived from melanoma-associated TYR antigen (QNILLSNAPLGPQFP and DYSYLQDSDPDSFQD), triggering CD4-positive T cell effector functions such as GMCSF production (PubMed:8642306). Displays preferentially citrullinated self-peptides derived from VIM (GVYATR/citSSAVR and SAVRAR/citSSVPGVR) and ACAN (VVLLVATEGR/ CitVRVNSAYQDK) (PubMed:24190431). Displays self-peptides derived from COL2A1 (PubMed:9354468)..; FUNCTION: Allele DRB1*04:02: Displays native or citrullinated self-peptides derived from VIM..; FUNCTION: Allele DRB1*04:04: May present to T-helper 1 cells several HRV-16 epitopes derived from capsid proteins VP1 (HIVMQYMYVPPGAPIPTTRN) and VP2 (RGDSTITSQDVANAVVGYGV), contributing to viral clearance (PubMed:27591323). Displays preferentially citrullinated self-peptides derived from VIM (SAVRAR/citSSVPGVR) (PubMed:24190431)..; FUNCTION: Allele DRB1*04:05: May present to T-helper 1 cells an immunogenic epitope derived from tumor-associated antigen WT1 (KRYFKLSHLQMHSRKH), likely providing for effective antitumor immunity in a wide range of solid and hematological malignancies..; FUNCTION: Allele DRB1*05:01: Presents an immunodominant HIV-1 gag peptide (FRDYVDRFYKTLRAEQASQE) on infected dendritic cells for recognition by TRAV24-TRBV2 TCR on CD4-positive T cells and controls viral load..; FUNCTION: Allele DRB1*07:01: Upon EBV infection, presents latent antigen EBNA2 peptide (PRSPTVFYNIPPMPLPPSQL) to CD4-positive T cells, driving oligoclonal expansion and selection of a dominant virus-specific memory T cell subset with cytotoxic potential to directly eliminate virus-infected B cells (PubMed:31308093). May present to T-helper 1 cells several HRV-16 epitopes derived from capsid proteins VP1 (PRFSLPFLSIASAYYMFYDG) and VP2 (VPYVNAVPMDSMVRHNNWSL), contributing to viral clearance (PubMed:27591323). In the context of tumor immunesurveillance, may present to T-helper 1 cells an immunogenic epitope derived from tumor-associated antigen WT1 (MTEYKLVVVGAVGVGKSALTIQLI), likely providing for effective antitumor immunity in a wide range of solid and hematological malignancies (PubMed:22929521). In metastatic epithelial tumors, presents to intratumoral CD4-positive T cells a KRAS neoantigen (MTEYKLVVVGAVGVGKSALTIQLI) carrying G12V hotspot driver mutation and may mediate tumor regression (PubMed:30282837)..; FUNCTION: Allele DRB1*11:01: Displays an immunodominant HIV-1 gag peptide (FRDYVDRFYKTLRAEQASQE) on infected dendritic cells for recognition by TRAV24-TRBV2 TCR on CD4-positive T cells and controls viral load (PubMed:29884618). May present to T-helper 1 cells an HRV-16 epitope derived from capsid protein VP2 (SDRIIQITRGDSTITSQDVA), contributing to viral clearance (PubMed:27591323). Presents several immunogenic epitopes derived from C.tetani neurotoxin tetX, playing a role in immune recognition and longterm protection (PubMed:19830726). In the context of tumor immunesurveillance, may present tumor-derived neoantigens to CD4-positive T cells and trigger anti-tumor helper functions (PubMed:31495665)..; FUNCTION: Allele DRB1*13:01: Presents viral epitopes derived from HHV-6B antigens to polyfunctional CD4-positive T cells implicated in control of HHV-6B infection..; FUNCTION: Allele DRB1*15:01: May present to T-helper 1 cells an HRV-16 epitope derived from capsid protein VP2 (SNNSATLIVPYVNAVPMDSM), contributing to viral clearance (PubMed:27591323). Displays a self-peptide derived from MBP (ENPVVHFFKNIVTPR) (PubMed:25413013, PubMed:9782128). May present to T-helper 1 cells an immunogenic epitope derived from tumor-associated antigen WT1 (KRYFKLSHLQMHSRKH), likely providing for effective antitumor immunity in a wide range of solid and hematological malignancies..; FUNCTION: Allele DRB1*15:02: Displays an immunodominant HIV-1 gag peptide (FRDYVDRFYKTLRAEQASQE) on infected dendritic cells for recognition by TRAV24-TRBV2 TCR on CD4-positive T cells and controls viral load (PubMed:29884618). May present to T-helper 1 cells an immunogenic epitope derived from tumor-associated antigen WT1 (KRYFKLSHLQMHSRKH), likely providing for effective antitumor immunity in a wide range of solid and hematological malignancies (PubMed:19120973)..; FUNCTION: (Microbial infection) Acts as a receptor for Epstein-Barr virus on lymphocytes..
Molecular Weight: 30kDa

Antibody Characteristics

Clonality: Monoclonal
Application: WBIHCELISA
Clone: ARC2360
Isotype: IgG
Form: Liquid
Immunogen: Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species: Human
Host Species: Rabbit
Species Reactivity: Human

Back to Product Catalog