Antibodies

Anti-HLA-G Antibody-Oligo Conjugate

SKU: aoc2314

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-HLA-G Antibody-IF1

Antibody Target

Target
HLA class I histocompatibility antigen, alpha chain G
UniProt Number
P17693
Target Description
[Isoform 1]: Non-classical major histocompatibility class Ib molecule involved in immune regulatory processes at the maternal-fetal interface. In complex with B2M/beta-2 microglobulin binds a limited repertoire of nonamer self-peptides derived from intracellular proteins including histones and ribosomal proteins. Peptide-bound HLA-G-B2M complex acts as a ligand for inhibitory/activating KIR2DL4, LILRB1 and LILRB2 receptors on uterine immune cells to promote fetal development while maintaining maternal-fetal tolerance. Upon interaction with KIR2DL4 and LILRB1 receptors on decidual NK cells, it triggers NK cell senescence-associated secretory phenotype as a molecular switch to promote vascular remodeling and fetal growth in early pregnancy. Through interaction with KIR2DL4 receptor on decidual macrophages induces pro-inflammatory cytokine production mainly associated with tissue remodeling. Through interaction with LILRB2 receptor triggers differentiation of type 1 regulatory T cells and myeloid-derived suppressor cells, both of which actively maintain maternal-fetal tolerance. May play a role in balancing tolerance and antiviral-immunity at maternal-fetal interface by keeping in check the effector functions of NK, CD8+ T cells and B cells. Reprograms B cells toward an immune suppressive phenotype via LILRB1. May induce immune activation/suppression via intercellular membrane transfer (trogocytosis), likely enabling interaction with KIR2DL4, which resides mostly in endosomes. Through interaction with the inhibitory receptor CD160 on endothelial cells may control angiogenesis in immune privileged sites.; FUNCTION: [Isoform 2]: Likely does not bind B2M and presents peptides. Negatively regulates NK cell- and CD8+ T cell-mediated cytotoxicity.; FUNCTION: [Isoform 3]: Likely does not bind B2M and presents peptides. Negatively regulates NK cell- and CD8+ T cell-mediated cytotoxicity.; FUNCTION: [Isoform 4]: Likely does not bind B2M and presents peptides. Negatively regulates NK cell- and CD8+ T cell-mediated cytotoxicity.; FUNCTION: [Isoform 5]: Non-classical major histocompatibility class Ib molecule involved in immune regulatory processes at the maternal-fetal interface. In complex with B2M/beta-2 microglobulin binds a limited repertoire of nonamer self-peptides derived from intracellular proteins including histones and ribosomal proteins. Peptide-bound HLA-G-B2M complex acts as a ligand for inhibitory/activating KIR2DL4, LILRB1 and LILRB2 receptors on uterine immune cells to promote fetal development while maintaining maternal-fetal tolerance. Upon interaction with KIR2DL4 and LILRB1 receptors on decidual NK cells, it triggers NK cell senescence-associated secretory phenotype as a molecular switch to promote vascular remodeling and fetal growth in early pregnancy. Through interaction with KIR2DL4 receptor on decidual macrophages induces pro-inflammatory cytokine production mainly associated with tissue remodeling. Through interaction with LILRB2 receptor triggers differentiation of type 1 regulatory T cells and myeloid-derived suppressor cells, both of which actively maintain maternal-fetal tolerance. Reprograms B cells toward an immune suppressive phenotype via LILRB1.; FUNCTION: [Isoform 6]: Likely does not bind B2M and presents peptides.; FUNCTION: [Isoform 7]: Likely does not bind B2M and presents peptides.
Molecular Weight
38kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBICCELISA
Clone
ARC63292
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
Human