Antibodies
Anti-HLA-G Antibody-Oligo Conjugate
SKU: aoc2314
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HLA-G Antibody-IF1
Antibody Target
- Target
- HLA class I histocompatibility antigen, alpha chain G
- UniProt Number
- P17693
- Target Description
- [Isoform 1]: Non-classical major histocompatibility class Ib molecule involved in immune regulatory processes at the maternal-fetal interface (PubMed:19304799, PubMed:23184984, PubMed:29262349). In complex with B2M/beta-2 microglobulin binds a limited repertoire of nonamer self-peptides derived from intracellular proteins including histones and ribosomal proteins (PubMed:7584149, PubMed:8805247). Peptide-bound HLA-G-B2M complex acts as a ligand for inhibitory/activating KIR2DL4, LILRB1 and LILRB2 receptors on uterine immune cells to promote fetal development while maintaining maternal-fetal tolerance (PubMed:16366734, PubMed:19304799, PubMed:20448110, PubMed:23184984, PubMed:27859042, PubMed:29262349). Upon interaction with KIR2DL4 and LILRB1 receptors on decidual NK cells, it triggers NK cell senescence-associated secretory phenotype as a molecular switch to promote vascular remodeling and fetal growth in early pregnancy (PubMed:16366734, PubMed:19304799, PubMed:23184984, PubMed:29262349). Through interaction with KIR2DL4 receptor on decidual macrophages induces pro-inflammatory cytokine production mainly associated with tissue remodeling (PubMed:19304799). Through interaction with LILRB2 receptor triggers differentiation of type 1 regulatory T cells and myeloid-derived suppressor cells, both of which actively maintain maternal-fetal tolerance (PubMed:20448110, PubMed:27859042). May play a role in balancing tolerance and antiviral-immunity at maternal-fetal interface by keeping in check the effector functions of NK, CD8+ T cells and B cells (PubMed:10190900, PubMed:11290782, PubMed:24453251). Reprograms B cells toward an immune suppressive phenotype via LILRB1 (PubMed:24453251). May induce immune activation/suppression via intercellular membrane transfer (trogocytosis), likely enabling interaction with KIR2DL4, which resides mostly in endosomes (PubMed:20179272, PubMed:26460007). Through interaction with the inhibitory receptor CD160 on endothelial cells may control angiogenesis in immune privileged sites (PubMed:16809620)..; FUNCTION: [Isoform 2]: Likely does not bind B2M and presents peptides. Negatively regulates NK cell- and CD8+ T cell-mediated cytotoxicity (PubMed:11290782)..; FUNCTION: [Isoform 3]: Likely does not bind B2M and presents peptides. Negatively regulates NK cell- and CD8+ T cell-mediated cytotoxicity (PubMed:11290782)..; FUNCTION: [Isoform 4]: Likely does not bind B2M and presents peptides. Negatively regulates NK cell- and CD8+ T cell-mediated cytotoxicity (PubMed:11290782)..; FUNCTION: [Isoform 5]: Non-classical major histocompatibility class Ib molecule involved in immune regulatory processes at the maternal-fetal interface (PubMed:19304799, PubMed:23184984, PubMed:29262349). In complex with B2M/beta-2 microglobulin binds a limited repertoire of nonamer self-peptides derived from intracellular proteins including histones and ribosomal proteins (PubMed:7584149, PubMed:8805247). Peptide-bound HLA-G-B2M complex acts as a ligand for inhibitory/activating KIR2DL4, LILRB1 and LILRB2 receptors on uterine immune cells to promote fetal development while maintaining maternal-fetal tolerance (PubMed:16366734, PubMed:19304799, PubMed:20448110, PubMed:23184984, PubMed:29262349). Upon interaction with KIR2DL4 and LILRB1 receptors on decidual NK cells, it triggers NK cell senescence-associated secretory phenotype as a molecular switch to promote vascular remodeling and fetal growth in early pregnancy (PubMed:16366734, PubMed:19304799, PubMed:23184984, PubMed:29262349). Through interaction with KIR2DL4 receptor on decidual macrophages induces pro-inflammatory cytokine production mainly associated with tissue remodeling (PubMed:19304799). Through interaction with LILRB2 receptor triggers differentiation of type 1 regulatory T cells and myeloid-derived suppressor cells, both of which actively maintain maternal-fetal tolerance (PubMed:20448110). Reprograms B cells toward an immune suppressive phenotype via LILRB1 (PubMed:24453251)..; FUNCTION: [Isoform 6]: Likely does not bind B2M and presents peptides..; FUNCTION: [Isoform 7]: Likely does not bind B2M and presents peptides..
- Molecular Weight
- 38kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC63292
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human