Antibodies
Anti-HMGA1 Antibody-Oligo Conjugate
SKU: aoc2317
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HMGA1 Antibody-IF1
Antibody Target
- Target
- High mobility group protein HMG-I/HMG-Y
- UniProt Number
- P17096
- Target Description
- HMG-I/Y bind preferentially to the minor groove of A+T rich regions in double-stranded DNA. It is suggested that these proteins could function in nucleosome phasing and in the 3'-end processing of mRNA transcripts. They are also involved in the transcription regulation of genes containing, or in close proximity to A+T-rich regions.
- Molecular Weight
- 12kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISAChIP-seq
- Clone
- ARC1060
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat