Antibodies
Anti-HMGB2 Antibody-Oligo Conjugate
SKU: aoc2319
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HMGB2 Antibody-IF1
Antibody Target
- Target
- High mobility group protein B2
- UniProt Number
- P26583
- Target Description
- Multifunctional protein with various roles in different cellular compartments. May act in a redox sensitive manner. In the nucleus is an abundant chromatin-associated non-histone protein involved in transcription, chromatin remodeling and V(D)J recombination and probably other processes. Binds DNA with a preference to non-canonical DNA structures such as single-stranded DNA. Can bent DNA and enhance DNA flexibility by looping thus providing a mechanism to promote activities on various gene promoters by enhancing transcription factor binding and/or bringing distant regulatory sequences into close proximity (PubMed:11909973, PubMed:18413230, PubMed:19522541, PubMed:19965638, PubMed:20123072, PubMed:7797075). Involved in V(D)J recombination by acting as a cofactor of the RAG complex: acts by stimulating cleavage and RAG protein binding at the 23 bp spacer of conserved recombination signal sequences (RSS) (By similarity). Proposed to be involved in the innate immune response to nucleic acids by acting as a promiscuous immunogenic DNA/RNA sensor which cooperates with subsequent discriminative sensing by specific pattern recognition receptors (By similarity). In the extracellular compartment acts as a chemokine. Promotes proliferation and migration of endothelial cells implicating AGER/RAGE (PubMed:19811285). Has antimicrobial activity in gastrointestinal epithelial tissues (PubMed:23877675). Involved in inflammatory response to antigenic stimulus coupled with pro-inflammatory activity (By similarity). Involved in modulation of neurogenesis probably by regulation of neural stem proliferation (By similarity). Involved in articular cartilage surface maintenance implicating LEF1 and the Wnt/beta-catenin pathway (By similarity)..
- Molecular Weight
- 24 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISAChIPCUT&Tag
- Clone
- ARC1460
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat