Antibodies
Anti-hnRNP A1 Antibody-Oligo Conjugate
SKU: aoc2324
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-hnRNP A1 Antibody-IF1
Antibody Target
- Target
- Heterogeneous nuclear ribonucleoprotein A1
- UniProt Number
- P09651
- Target Description
- Involved in the packaging of pre-mRNA into hnRNP particles, transport of poly(A) mRNA from the nucleus to the cytoplasm and modulation of splice site selection. Plays a role in the splicing of pyruvate kinase PKM by binding repressively to sequences flanking PKM exon 9, inhibiting exon 9 inclusion and resulting in exon 10 inclusion and production of the PKM M2 isoform. Binds to the IRES and thereby inhibits the translation of the apoptosis protease activating factor APAF1. May bind to specific miRNA hairpins.; FUNCTION: (Microbial infection) May play a role in HCV RNA replication.; FUNCTION: (Microbial infection) Cleavage by Enterovirus 71 protease 3C results in increased translation of apoptosis protease activating factor APAF1, leading to apoptosis.
- Molecular Weight
- 39kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC0633
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat