Antibodies
Anti-hnRNP A1 Antibody-Oligo Conjugate
SKU: aoc2324
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-hnRNP A1 Antibody-IF1
Antibody Target
- Target
- Heterogeneous nuclear ribonucleoprotein A1
- UniProt Number
- P09651
- Target Description
- Involved in the packaging of pre-mRNA into hnRNP particles, transport of poly(A) mRNA from the nucleus to the cytoplasm and modulation of splice site selection (PubMed:17371836). Plays a role in the splicing of pyruvate kinase PKM by binding repressively to sequences flanking PKM exon 9, inhibiting exon 9 inclusion and resulting in exon 10 inclusion and production of the PKM M2 isoform (PubMed:20010808). Binds to the IRES and thereby inhibits the translation of the apoptosis protease activating factor APAF1 (PubMed:31498791). May bind to specific miRNA hairpins (PubMed:28431233)..; FUNCTION: (Microbial infection) May play a role in HCV RNA replication..; FUNCTION: (Microbial infection) Cleavage by Enterovirus 71 protease 3C results in increased translation of apoptosis protease activating factor APAF1, leading to apoptosis..
- Molecular Weight
- 39kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC0633
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat