Antibodies
Anti-hnRNP K Antibody-Oligo Conjugate
SKU: aoc2327
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-hnRNP K Antibody-IF1
Antibody Target
- Target
- Heterogeneous nuclear ribonucleoprotein K
- UniProt Number
- P61978
- Target Description
- One of the major pre-mRNA-binding proteins. Binds tenaciously to poly(C) sequences. Likely to play a role in the nuclear metabolism of hnRNAs, particularly for pre-mRNAs that contain cytidine-rich sequences. Can also bind poly(C) single-stranded DNA. Plays an important role in p53/TP53 response to DNA damage, acting at the level of both transcription activation and repression. When sumoylated, acts as a transcriptional coactivator of p53/TP53, playing a role in p21/CDKN1A and 14-3-3 sigma/SFN induction (By similarity). As far as transcription repression is concerned, acts by interacting with long intergenic RNA p21 (lincRNA-p21), a non-coding RNA induced by p53/TP53. This interaction is necessary for the induction of apoptosis, but not cell cycle arrest. As part of a ribonucleoprotein complex composed at least of ZNF827, HNRNPL and the circular RNA circZNF827 that nucleates the complex on chromatin, may negatively regulate the transcription of genes involved in neuronal differentiation (PubMed:33174841)..
- Molecular Weight
- 49kDa/51kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC0512
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat