Antibodies
Anti-hnRNP K Antibody-Oligo Conjugate
SKU: aoc2327
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-hnRNP K Antibody-IF1
Antibody Target
- Target
- Heterogeneous nuclear ribonucleoprotein K
- UniProt Number
- P61978
- Target Description
- One of the major pre-mRNA-binding proteins. Binds tenaciously to poly(C) sequences. Likely to play a role in the nuclear metabolism of hnRNAs, particularly for pre-mRNAs that contain cytidine-rich sequences. Can also bind poly(C) single-stranded DNA. Plays an important role in p53/TP53 response to DNA damage, acting at the level of both transcription activation and repression. When sumoylated, acts as a transcriptional coactivator of p53/TP53, playing a role in p21/CDKN1A and 14-3-3 sigma/SFN induction. As far as transcription repression is concerned, acts by interacting with long intergenic RNA p21 (lincRNA-p21), a non-coding RNA induced by p53/TP53. This interaction is necessary for the induction of apoptosis, but not cell cycle arrest. As part of a ribonucleoprotein complex composed at least of ZNF827, HNRNPL and the circular RNA circZNF827 that nucleates the complex on chromatin, may negatively regulate the transcription of genes involved in neuronal differentiation.
- Molecular Weight
- 49kDa/51kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC0512
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat