Antibodies
Anti-hnRNP Q/SYNCRIP Antibody-Oligo Conjugate
SKU: aoc2328
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-hnRNP Q/SYNCRIP Antibody-IF1
Antibody Target
- Target
- Heterogeneous nuclear ribonucleoprotein Q
- UniProt Number
- O60506
- Target Description
- Heterogenous nuclear ribonucleoprotein (hnRNP) implicated in mRNA processing mechanisms. Component of the CRD-mediated complex that promotes MYC mRNA stability. Isoform 1, isoform 2 and isoform 3 are associated in vitro with pre-mRNA, splicing intermediates and mature mRNA protein complexes. Isoform 1 binds to apoB mRNA AU-rich sequences. Isoform 1 is part of the APOB mRNA editosome complex and may modulate the postranscriptional C to U RNA-editing of the APOB mRNA through either by binding to A1CF (APOBEC1 complementation factor), to APOBEC1 or to RNA itself. May be involved in translationally coupled mRNA turnover. Implicated with other RNA-binding proteins in the cytoplasmic deadenylation/translational and decay interplay of the FOS mRNA mediated by the major coding-region determinant of instability (mCRD) domain. Interacts in vitro preferentially with poly(A) and poly(U) RNA sequences. Isoform 3 may be involved in cytoplasmic vesicle-based mRNA transport through interaction with synaptotagmins. Component of the GAIT (gamma interferon-activated inhibitor of translation) complex which mediates interferon-gamma-induced transcript-selective translation inhibition in inflammation processes. Upon interferon-gamma activation assembles into the GAIT complex which binds to stem loop-containing GAIT elements in the 3'-UTR of diverse inflammatory mRNAs (such as ceruplasmin) and suppresses their translation; seems not to be essential for GAIT complex function.
- Molecular Weight
- 70kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1656
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat