Antibodies
Anti-HNRNPC Antibody-Oligo Conjugate
SKU: aoc2330
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HNRNPC Antibody-IF1
Antibody Target
- Target
- Heterogeneous nuclear ribonucleoproteins C1/C2
- UniProt Number
- P07910
- Target Description
- Binds pre-mRNA and nucleates the assembly of 40S hnRNP particles. Interacts with poly-U tracts in the 3'-UTR or 5'-UTR of mRNA and modulates the stability and the level of translation of bound mRNA molecules. Single HNRNPC tetramers bind 230-240 nucleotides. Trimers of HNRNPC tetramers bind 700 nucleotides. May play a role in the early steps of spliceosome assembly and pre-mRNA splicing. N6-methyladenosine (m6A) has been shown to alter the local structure in mRNAs and long non-coding RNAs (lncRNAs) via a mechanism named 'm(6)A-switch', facilitating binding of HNRNPC, leading to regulation of mRNA splicing.
- Molecular Weight
- 34kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PELISA
- Clone
- ARC1366
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse