Antibodies
Anti-HNRNPD Antibody-Oligo Conjugate
SKU: aoc2331
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HNRNPD Antibody-IF1
Antibody Target
- Target
- Heterogeneous nuclear ribonucleoprotein D0
- UniProt Number
- Q14103
- Target Description
- Binds with high affinity to RNA molecules that contain AU-rich elements (AREs) found within the 3'-UTR of many proto-oncogenes and cytokine mRNAs. Also binds to double- and single-stranded DNA sequences in a specific manner and functions a transcription factor. Each of the RNA-binding domains specifically can bind solely to a single-stranded non-monotonous 5'-UUAG-3' sequence and also weaker to the single-stranded 5'-TTAGGG-3' telomeric DNA repeat. Binds RNA oligonucleotides with 5'-UUAGGG-3' repeats more tightly than the telomeric single-stranded DNA 5'-TTAGGG-3' repeats. Binding of RRM1 to DNA inhibits the formation of DNA quadruplex structure which may play a role in telomere elongation. May be involved in translationally coupled mRNA turnover. Implicated with other RNA-binding proteins in the cytoplasmic deadenylation/translational and decay interplay of the FOS mRNA mediated by the major coding-region determinant of instability (mCRD) domain. May play a role in the regulation of the rhythmic expression of circadian clock core genes. Directly binds to the 3'UTR of CRY1 mRNA and induces CRY1 rhythmic translation. May also be involved in the regulation of PER2 translation..
- Molecular Weight
- 38 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC59955
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat