Antibodies
Anti-HOPX Antibody-Oligo Conjugate
SKU: aoc2335
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HOPX Antibody-IF1
Antibody Target
- Target
- Homeodomain-only protein
- UniProt Number
- Q9BPY8
- Target Description
- Atypical homeodomain protein which does not bind DNA and is required to modulate cardiac growth and development. Acts via its interaction with SRF, thereby modulating the expression of SRF-dependent cardiac-specific genes and cardiac development. Prevents SRF-dependent transcription either by inhibiting SRF binding to DNA or by recruiting histone deacetylase (HDAC) proteins that prevent transcription by SRF. Overexpression causes cardiac hypertrophy. May act as a tumor suppressor. Acts as a co-chaperone for HSPA1A and HSPA1B chaperone proteins and assists in chaperone-mediated protein refolding.
- Molecular Weight
- 8 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIF-PIHCELISA
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat