Antibodies
Anti-HOXA9 Antibody-Oligo Conjugate
SKU: aoc2337
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HOXA9 Antibody-IF1
Antibody Target
- Target
- Homeobox protein Hox-A9
- UniProt Number
- P31269
- Target Description
- Sequence-specific transcription factor which is part of a developmental regulatory system that provides cells with specific positional identities on the anterior-posterior axis. Required for induction of SELE/E-selectin and VCAM1 on the endothelial cells surface at sites of inflammation. Positively regulates EIF4E-mediated mRNA nuclear export and also increases the translation efficiency of ODC mRNA in the cytoplasm by competing with factors which repress EIF4E activity such as PRH.
- Molecular Weight
- 30kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2423
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat