Antibodies
Anti-HP1 alpha Antibody-Oligo Conjugate
SKU: aoc2341
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HP1 alpha Antibody-IF1
Antibody Target
- Target
- Chromobox protein homolog 5
- UniProt Number
- P45973
- Target Description
- Component of heterochromatin that recognizes and binds histone H3 tails methylated at 'Lys-9' (H3K9me), leading to epigenetic repression. In contrast, it is excluded from chromatin when 'Tyr-41' of histone H3 is phosphorylated (H3Y41ph) (PubMed:19783980). May contribute to the association of heterochromatin with the inner nuclear membrane by interactions with the lamin-B receptor (LBR) (PubMed:19783980). Involved in the formation of kinetochore through interaction with the MIS12 complex subunit NSL1 (PubMed:19783980, PubMed:20231385). Required for the formation of the inner centromere (PubMed:20231385)..
- Molecular Weight
- 22kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC0244
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat