Antibodies
Anti-HP1 gamma/CBX3 Antibody-Oligo Conjugate
SKU: aoc2342
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HP1 gamma/CBX3 Antibody-IF1
Antibody Target
- Target
- Chromobox protein homolog 3
- UniProt Number
- Q13185
- Target Description
- Seems to be involved in transcriptional silencing in heterochromatin-like complexes. Recognizes and binds histone H3 tails methylated at 'Lys-9', leading to epigenetic repression. May contribute to the association of the heterochromatin with the inner nuclear membrane through its interaction with lamin B receptor (LBR). Involved in the formation of functional kinetochore through interaction with MIS12 complex proteins. Contributes to the conversion of local chromatin to a heterochromatin-like repressive state through H3 'Lys-9' trimethylation, mediates the recruitment of the methyltransferases SUV39H1 and/or SUV39H2 by the PER complex to the E-box elements of the circadian target genes such as PER2 itself or PER1. Mediates the recruitment of NIPBL to sites of DNA damage at double-strand breaks (DSBs) (PubMed:28167679)..
- Molecular Weight
- 21kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0952
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat