Antibodies
Anti-HRH3 Antibody-Oligo Conjugate
SKU: aoc2344
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-HRH3 Antibody-PLA1
Antibody Target
- Target
- Histamine H3 receptor
- UniProt Number
- Q9Y5N1
- Target Description
- The H3 subclass of histamine receptors could mediate the histamine signals in CNS and peripheral nervous system. Signals through the inhibition of adenylate cyclase and displays high constitutive activity (spontaneous activity in the absence of agonist). Agonist stimulation of isoform 3 neither modified adenylate cyclase activity nor induced intracellular calcium mobilization.
- Molecular Weight
- 49kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC2016
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat