Antibodies
Anti-HSD17B2 Antibody-Oligo Conjugate
SKU: aoc2348
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HSD17B2 Antibody-IF1
Antibody Target
- Target
- 17-beta-hydroxysteroid dehydrogenase type 2
- UniProt Number
- P37059
- Target Description
- Catalyzes the NAD-dependent oxidation of the highly active 17beta-hydroxysteroids, such as estradiol (E2), testosterone (T), and dihydrotestosterone (DHT), to their less active forms and thus regulates the biological potency of these steroids. Oxidizes estradiol to estrone, testosterone to androstenedione, and dihydrotestosterone to 5alpha-androstan-3,17-dione. Also has 20-alpha-HSD activity.
- Molecular Weight
- 43kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC73082
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat