Antibodies
Anti-HSF1 Antibody-Oligo Conjugate
SKU: aoc2350
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HSF1 Antibody-IF1
Antibody Target
- Target
- Heat shock factor protein 1
- UniProt Number
- Q00613
- Target Description
- Functions as a stress-inducible and DNA-binding transcription factor that plays a central role in the transcriptional activation of the heat shock response (HSR), leading to the expression of a large class of molecular chaperones, heat shock proteins (HSPs), that protect cells from cellular insult damage (PubMed:11447121, PubMed:12659875, PubMed:12917326, PubMed:15016915, PubMed:18451878, PubMed:1871105, PubMed:1986252, PubMed:25963659, PubMed:26754925, PubMed:7623826, PubMed:7760831, PubMed:8940068, PubMed:8946918, PubMed:9121459, PubMed:9341107, PubMed:9499401, PubMed:9535852, PubMed:9727490). In unstressed cells, is present in a HSP90-containing multichaperone complex that maintains it in a non-DNA-binding inactivated monomeric form (PubMed:11583998, PubMed:16278218, PubMed:9727490). Upon exposure to heat and other stress stimuli, undergoes homotrimerization and activates HSP gene transcription through binding to site-specific heat shock elements (HSEs) present in the promoter regions of HSP genes (PubMed:10359787, PubMed:11583998, PubMed:12659875, PubMed:16278218, PubMed:1871105, PubMed:1986252, PubMed:25963659, PubMed:26754925, PubMed:7623826, PubMed:7935471, PubMed:8455624, PubMed:8940068, PubMed:9499401, PubMed:9727490). Upon heat shock stress, forms a chromatin-associated complex with TTC5/STRAP and p300/EP300 to stimulate HSR transcription, therefore increasing cell survival (PubMed:18451878). Activation is reversible, and during the attenuation and recovery phase period of the HSR, returns to its unactivated form (PubMed:11583998, PubMed:16278218). Binds to inverted 5'-NGAAN-3' pentamer DNA sequences (PubMed:1986252, PubMed:26727489). Binds to chromatin at heat shock gene promoters (PubMed:25963659). Activates transcription of transcription factor FOXR1 which in turn activates transcription of the heat shock chaperones HSPA1A and HSPA6 and the antioxidant NADPH-dependent reductase DHRS2 (PubMed:34723967). Also serves several other functions independently of its transcriptional activity. Involved in the repression of Ras-induced transcriptional activation of the c-fos gene in heat-stressed cells (PubMed:9341107). Positively regulates pre-mRNA 3'-end processing and polyadenylation of HSP70 mRNA upon heat-stressed cells in a symplekin (SYMPK)-dependent manner (PubMed:14707147). Plays a role in nuclear export of stress-induced HSP70 mRNA (PubMed:17897941). Plays a role in the regulation of mitotic progression (PubMed:18794143). Also plays a role as a negative regulator of non-homologous end joining (NHEJ) repair activity in a DNA damage-dependent manner (PubMed:26359349). Involved in stress-induced cancer cell proliferation in a IER5-dependent manner (PubMed:26754925)..; FUNCTION: (Microbial infection) Plays a role in latent human immunodeficiency virus (HIV-1) transcriptional reactivation. Binds to the HIV-1 long terminal repeat promoter (LTR) to reactivate viral transcription by recruiting cellular transcriptional elongation factors, such as CDK9, CCNT1 and EP300..
- Molecular Weight
- 57kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC61341
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat