Antibodies

Anti-HSF1 Antibody-Oligo Conjugate

SKU: aoc2350

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-HSF1 Antibody-IF1

Antibody Target

Target
Heat shock factor protein 1
UniProt Number
Q00613
Target Description
Functions as a stress-inducible and DNA-binding transcription factor that plays a central role in the transcriptional activation of the heat shock response (HSR), leading to the expression of a large class of molecular chaperones, heat shock proteins (HSPs), that protect cells from cellular insult damage. In unstressed cells, is present in a HSP90-containing multichaperone complex that maintains it in a non-DNA-binding inactivated monomeric form. Upon exposure to heat and other stress stimuli, undergoes homotrimerization and activates HSP gene transcription through binding to site-specific heat shock elements (HSEs) present in the promoter regions of HSP genes. Upon heat shock stress, forms a chromatin-associated complex with TTC5/STRAP and p300/EP300 to stimulate HSR transcription, therefore increasing cell survival. Activation is reversible, and during the attenuation and recovery phase period of the HSR, returns to its unactivated form. Binds to inverted 5'-NGAAN-3' pentamer DNA sequences. Binds to chromatin at heat shock gene promoters. Activates transcription of transcription factor FOXR1 which in turn activates transcription of the heat shock chaperones HSPA1A and HSPA6 and the antioxidant NADPH-dependent reductase DHRS2. Also serves several other functions independently of its transcriptional activity. Involved in the repression of Ras-induced transcriptional activation of the c-fos gene in heat-stressed cells. Positively regulates pre-mRNA 3'-end processing and polyadenylation of HSP70 mRNA upon heat-stressed cells in a symplekin (SYMPK)-dependent manner. Plays a role in nuclear export of stress-induced HSP70 mRNA. Plays a role in the regulation of mitotic progression. Also plays a role as a negative regulator of non-homologous end joining (NHEJ) repair activity in a DNA damage-dependent manner. Involved in stress-induced cancer cell proliferation in a IER5-dependent manner.; FUNCTION: (Microbial infection) Plays a role in latent human immunodeficiency virus (HIV-1) transcriptional reactivation. Binds to the HIV-1 long terminal repeat promoter (LTR) to reactivate viral transcription by recruiting cellular transcriptional elongation factors, such as CDK9, CCNT1 and EP300.
Molecular Weight
57kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCIPELISA
Clone
ARC61341
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat