Antibodies
Anti-HSL Antibody-Oligo Conjugate
SKU: aoc2351
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HSL Antibody-IF1
Antibody Target
- Target
- Hormone-sensitive lipase
- UniProt Number
- Q05469
- Target Description
- Lipase with broad substrate specificity, catalyzing the hydrolysis of triacylglycerols (TAGs), diacylglycerols (DAGs), monoacylglycerols (MAGs), cholesteryl esters and retinyl esters. Shows a preferential hydrolysis of DAGs over TAGs and MAGs and preferentially hydrolyzes the fatty acid (FA) esters at the sn-3 position of the glycerol backbone in DAGs. Preferentially hydrolyzes FA esters at the sn-1 and sn-2 positions of the glycerol backbone in TAGs. Catalyzes the hydrolysis of 2-arachidonoylglycerol, an endocannabinoid and of 2-acetyl monoalkylglycerol ether, the penultimate precursor of the pathway for de novo synthesis of platelet-activating factor. In adipose tissue and heart, it primarily hydrolyzes stored triglycerides to free fatty acids, while in steroidogenic tissues, it principally converts cholesteryl esters to free cholesterol for steroid hormone production.
- Molecular Weight
- 117kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC64016
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse