Antibodies
Anti-HSP20 Antibody-Oligo Conjugate
SKU: aoc2352
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HSP20 Antibody-IF1
Antibody Target
- Target
- Heat shock protein beta-6
- UniProt Number
- O14558
- Target Description
- Small heat shock protein which functions as a molecular chaperone probably maintaining denatured proteins in a folding-competent state. Seems to have versatile functions in various biological processes. Plays a role in regulating muscle function such as smooth muscle vasorelaxation and cardiac myocyte contractility. May regulate myocardial angiogenesis implicating KDR. Overexpression mediates cardioprotection and angiogenesis after induced damage. Stabilizes monomeric YWHAZ thereby supporting YWHAZ chaperone-like activity.
- Molecular Weight
- 17kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC1787
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat