Antibodies
Anti-HSP27 Antibody-Oligo Conjugate (ARC75566)
SKU: aoc2353
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HSP27 Antibody (ARC75566)-IF1
Antibody Target
- Target
- Heat shock protein beta-1
- UniProt Number
- P04792
- Target Description
- Small heat shock protein which functions as a molecular chaperone probably maintaining denatured proteins in a folding-competent state (PubMed:10383393, PubMed:20178975). Plays a role in stress resistance and actin organization (PubMed:19166925). Through its molecular chaperone activity may regulate numerous biological processes including the phosphorylation and the axonal transport of neurofilament proteins (PubMed:23728742)..
- Molecular Weight
- 23kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPICCIHCELISA
- Clone
- ARC75566
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human