Antibodies
Anti-HSP60 Antibody-Oligo Conjugate
SKU: aoc2357
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HSP60 Antibody-IF1
Antibody Target
- Target
- 60 kDa heat shock protein, mitochondrial
- UniProt Number
- P10809
- Target Description
- Chaperonin implicated in mitochondrial protein import and macromolecular assembly. Together with Hsp10, facilitates the correct folding of imported proteins. May also prevent misfolding and promote the refolding and proper assembly of unfolded polypeptides generated under stress conditions in the mitochondrial matrix. The functional units of these chaperonins consist of heptameric rings of the large subunit Hsp60, which function as a back-to-back double ring. In a cyclic reaction, Hsp60 ring complexes bind one unfolded substrate protein per ring, followed by the binding of ATP and association with 2 heptameric rings of the co-chaperonin Hsp10. This leads to sequestration of the substrate protein in the inner cavity of Hsp60 where, for a certain period of time, it can fold undisturbed by other cell components. Synchronous hydrolysis of ATP in all Hsp60 subunits results in the dissociation of the chaperonin rings and the release of ADP and the folded substrate protein (Probable).
- Molecular Weight
- 61 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPICCIHCELISA
- Clone
- ARC0260
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- A synthetic peptide corresponding to a sequence within amino acids 350-450 of human HSP60/HSPD1 (P10809).
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRatWheat