Antibodies
Anti-HSP70 Antibody-Oligo Conjugate
SKU: aoc2358
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HSP70 Antibody-IF1
Antibody Target
- Target
- Heat shock 70 kDa protein 1A
- UniProt Number
- P0DMV8
- Additional Target Information
- This antibody also binds Heat shock 70 kDa protein 1B, Uniprot:P0DMV9.
- Target Description
- Molecular chaperone implicated in a wide variety of cellular processes, including protection of the proteome from stress, folding and transport of newly synthesized polypeptides, activation of proteolysis of misfolded proteins and the formation and dissociation of protein complexes. Plays a pivotal role in the protein quality control system, ensuring the correct folding of proteins, the re-folding of misfolded proteins and controlling the targeting of proteins for subsequent degradation. This is achieved through cycles of ATP binding, ATP hydrolysis and ADP release, mediated by co-chaperones. The co-chaperones have been shown to not only regulate different steps of the ATPase cycle, but they also have an individual specificity such that one co-chaperone may promote folding of a substrate while another may promote degradation. The affinity for polypeptides is regulated by its nucleotide bound state. In the ATP-bound form, it has a low affinity for substrate proteins. However, upon hydrolysis of the ATP to ADP, it undergoes a conformational change that increases its affinity for substrate proteins. It goes through repeated cycles of ATP hydrolysis and nucleotide exchange, which permits cycles of substrate binding and release. The co-chaperones are of three types: J-domain co-chaperones such as HSP40s (stimulate ATPase hydrolysis by HSP70), the nucleotide exchange factors (NEF) such as BAG1/2/3 (facilitate conversion of HSP70 from the ADP-bound to the ATP-bound state thereby promoting substrate release), and the TPR domain chaperones such as HOPX and STUB1. Maintains protein homeostasis during cellular stress through two opposing mechanisms: protein refolding and degradation. Its acetylation/deacetylation state determines whether it functions in protein refolding or protein degradation by controlling the competitive binding of co-chaperones HOPX and STUB1. During the early stress response, the acetylated form binds to HOPX which assists in chaperone-mediated protein refolding, thereafter, it is deacetylated and binds to ubiquitin ligase STUB1 that promotes ubiquitin-mediated protein degradation. Regulates centrosome integrity during mitosis, and is required for the maintenance of a functional mitotic centrosome that supports the assembly of a bipolar mitotic spindle. Enhances STUB1-mediated SMAD3 ubiquitination and degradation and facilitates STUB1-mediated inhibition of TGF-beta signaling. Essential for STUB1-mediated ubiquitination and degradation of FOXP3 in regulatory T-cells (Treg) during inflammation. Required as a co-chaperone for optimal STUB1/CHIP ubiquitination of NFATC3. Negatively regulates heat shock-induced HSF1 transcriptional activity during the attenuation and recovery phase period of the heat shock response. Involved in the clearance of misfolded PRDM1/Blimp-1 proteins. Sequesters them in the cytoplasm and promotes their association with SYNV1/HRD1, leading to proteasomal degradation.; FUNCTION: (Microbial infection) In case of rotavirus A infection, serves as a post-attachment receptor for the virus to facilitate entry into the cell.
- Molecular Weight
- 70 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC53087
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat