Antibodies

Anti-Hsp90 Antibody-Oligo Conjugate

SKU: aoc2359

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-Hsp90 Antibody-IF1

Antibody Target

Target
Heat shock protein HSP 90-beta
UniProt Number
P08238
Target Description
Molecular chaperone that promotes the maturation, structural maintenance and proper regulation of specific target proteins involved for instance in cell cycle control and signal transduction. Undergoes a functional cycle linked to its ATPase activity. This cycle probably induces conformational changes in the client proteins, thereby causing their activation. Interacts dynamically with various co-chaperones that modulate its substrate recognition, ATPase cycle and chaperone function (PubMed:16478993, PubMed:19696785). Engages with a range of client protein classes via its interaction with various co-chaperone proteins or complexes, that act as adapters, simultaneously able to interact with the specific client and the central chaperone itself. Recruitment of ATP and co-chaperone followed by client protein forms a functional chaperone. After the completion of the chaperoning process, properly folded client protein and co-chaperone leave HSP90 in an ADP-bound partially open conformation and finally, ADP is released from HSP90 which acquires an open conformation for the next cycle (PubMed:26991466, PubMed:27295069). Apart from its chaperone activity, it also plays a role in the regulation of the transcription machinery. HSP90 and its co-chaperones modulate transcription at least at three different levels. They first alter the steady-state levels of certain transcription factors in response to various physiological cues. Second, they modulate the activity of certain epigenetic modifiers, such as histone deacetylases or DNA methyl transferases, and thereby respond to the change in the environment. Third, they participate in the eviction of histones from the promoter region of certain genes and thereby turn on gene expression (PubMed:25973397). Antagonizes STUB1-mediated inhibition of TGF-beta signaling via inhibition of STUB1-mediated SMAD3 ubiquitination and degradation (PubMed:24613385). Promotes cell differentiation by chaperoning BIRC2 and thereby protecting from auto-ubiquitination and degradation by the proteasomal machinery (PubMed:18239673). Main chaperone involved in the phosphorylation/activation of the STAT1 by chaperoning both JAK2 and PRKCE under heat shock and in turn, activates its own transcription (PubMed:20353823). Involved in the translocation into ERGIC (endoplasmic reticulum-Golgi intermediate compartment) of leaderless cargos (lacking the secretion signal sequence) such as the interleukin 1/IL-1; the translocation process is mediated by the cargo receptor TMED10 (PubMed:32272059)..; FUNCTION: (Microbial infection) Binding to N.meningitidis NadA stimulates monocytes (PubMed:21949862). Seems to interfere with N.meningitidis NadA-mediated invasion of human cells (Probable)..
Molecular Weight
83kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCICCELISA
Clone
ARC55011
Isotype
IgG
Form
Liquid
Immunogen
Recombinant protein (or fragment).This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRatRice