Antibodies
Anti-HuR Antibody-Oligo Conjugate
SKU: aoc2383
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-HuR Antibody-IF1
Antibody Target
- Target
- ELAV-like protein 1
- UniProt Number
- Q15717
- Target Description
- RNA-binding protein that binds to the 3'-UTR region of mRNAs and increases their stability (PubMed:14517288, PubMed:18285462, PubMed:31358969). Involved in embryonic stem cell (ESC) differentiation: preferentially binds mRNAs that are not methylated by N6-methyladenosine (m6A), stabilizing them, promoting ESC differentiation (By similarity). Has also been shown to be capable of binding to m6A-containing mRNAs and contributes to MYC stability by binding to m6A-containing MYC mRNAs (PubMed:32245947). Binds to poly-U elements and AU-rich elements (AREs) in the 3'-UTR of target mRNAs (PubMed:14731398, PubMed:17632515, PubMed:18285462, PubMed:23519412, PubMed:8626503). Binds avidly to the AU-rich element in FOS and IL3/interleukin-3 mRNAs. In the case of the FOS AU-rich element, binds to a core element of 27 nucleotides that contain AUUUA, AUUUUA, and AUUUUUA motifs. Binds preferentially to the 5'-UUUU[AG]UUU-3' motif in vitro (PubMed:8626503). With ZNF385A, binds the 3'-UTR of p53/TP53 mRNA to control their nuclear export induced by CDKN2A. Hence, may regulate p53/TP53 expression and mediate in part the CDKN2A anti-proliferative activity. May also bind with ZNF385A the CCNB1 mRNA (By similarity). Increases the stability of the leptin mRNA harboring an AU-rich element (ARE) in its 3' UTR (PubMed:29180010)..
- Molecular Weight
- 36kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC0101
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat