Antibodies
Anti-ICAM1 Antibody-Oligo Conjugate
SKU: aoc2385
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ICAM1 Antibody-IF1
Antibody Target
- Target
- Intercellular adhesion molecule 1
- UniProt Number
- P05362
- Target Description
- ICAM proteins are ligands for the leukocyte adhesion protein LFA-1 (integrin alpha-L/beta-2). During leukocyte trans-endothelial migration, ICAM1 engagement promotes the assembly of endothelial apical cups through ARHGEF26/SGEF and RHOG activation..; FUNCTION: (Microbial infection) Acts as a receptor for major receptor group rhinovirus A-B capsid proteins..; FUNCTION: (Microbial infection) Acts as a receptor for Coxsackievirus A21 capsid proteins..; FUNCTION: (Microbial infection) Upon Kaposi's sarcoma-associated herpesvirus/HHV-8 infection, is degraded by viral E3 ubiquitin ligase MIR2, presumably to prevent lysis of infected cells by cytotoxic T-lymphocytes and NK cell..
- Molecular Weight
- 58kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCFlow CytometryELISA
- Clone
- ARC0261
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human