Antibodies
Anti-IDE Antibody-Oligo Conjugate (ARC74108)
SKU: aoc2393
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IDE Antibody (ARC74108)-IF1
Antibody Target
- Target
- Insulin-degrading enzyme
- UniProt Number
- P14735
- Target Description
- Plays a role in the cellular breakdown of insulin, APP peptides, IAPP peptides, natriuretic peptides, glucagon, bradykinin, kallidin, and other peptides, and thereby plays a role in intercellular peptide signaling. Substrate binding induces important conformation changes, making it possible to bind and degrade larger substrates, such as insulin. Contributes to the regulation of peptide hormone signaling cascades and regulation of blood glucose homeostasis via its role in the degradation of insulin, glucagon and IAPP. Plays a role in the degradation and clearance of APP-derived amyloidogenic peptides that are secreted by neurons and microglia (Probable). Degrades the natriuretic peptides ANP, BNP and CNP, inactivating their ability to raise intracellular cGMP. Also degrades an aberrant frameshifted 40-residue form of NPPA (fsNPPA) which is associated with familial atrial fibrillation in heterozygous patients. Involved in antigen processing. Produces both the N terminus and the C terminus of MAGEA3-derived antigenic peptide (EVDPIGHLY) that is presented to cytotoxic T lymphocytes by MHC class I.; FUNCTION: (Microbial infection) The membrane-associated isoform acts as an entry receptor for varicella-zoster virus (VZV).
- Molecular Weight
- 118kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC74108
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat