Antibodies
Anti-IDE Antibody-Oligo Conjugate (ARC74108)
SKU: aoc2393
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IDE Antibody (ARC74108)-IF1
Antibody Target
- Target
- Insulin-degrading enzyme
- UniProt Number
- P14735
- Target Description
- Plays a role in the cellular breakdown of insulin, APP peptides, IAPP peptides, natriuretic peptides, glucagon, bradykinin, kallidin, and other peptides, and thereby plays a role in intercellular peptide signaling (PubMed:10684867, PubMed:17051221, PubMed:17613531, PubMed:18986166, PubMed:19321446, PubMed:21098034, PubMed:2293021, PubMed:23922390, PubMed:24847884, PubMed:26394692, PubMed:26968463, PubMed:29596046). Substrate binding induces important conformation changes, making it possible to bind and degrade larger substrates, such as insulin (PubMed:23922390, PubMed:26394692, PubMed:29596046). Contributes to the regulation of peptide hormone signaling cascades and regulation of blood glucose homeostasis via its role in the degradation of insulin, glucagon and IAPP (By similarity). Plays a role in the degradation and clearance of APP-derived amyloidogenic peptides that are secreted by neurons and microglia (Probable) (PubMed:26394692, PubMed:9830016). Degrades the natriuretic peptides ANP, BNP and CNP, inactivating their ability to raise intracellular cGMP (PubMed:21098034). Also degrades an aberrant frameshifted 40-residue form of NPPA (fsNPPA) which is associated with familial atrial fibrillation in heterozygous patients (PubMed:21098034). Involved in antigen processing. Produces both the N terminus and the C terminus of MAGEA3-derived antigenic peptide (EVDPIGHLY) that is presented to cytotoxic T lymphocytes by MHC class I..; FUNCTION: (Microbial infection) The membrane-associated isoform acts as an entry receptor for varicella-zoster virus (VZV)..
- Molecular Weight
- 118kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC74108
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat