Antibodies
Anti-IDH1 Antibody-Oligo Conjugate
SKU: aoc2395
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IDH1 Antibody-IF1
Antibody Target
- Target
- Isocitrate dehydrogenase [NADP] cytoplasmic
- UniProt Number
- O75874
- Target Description
- Catalyzes the NADP(+)-dependent oxidative decarboxylation of isocitrate (D-threo-isocitrate) to 2-ketoglutarate (2-oxoglutarate), which is required by other enzymes such as the phytanoyl-CoA dioxygenase. Plays a critical role in the generation of NADPH, an important cofactor in many biosynthesis pathways. May act as a corneal epithelial crystallin and may be involved in maintaining corneal epithelial transparency.
- Molecular Weight
- 47kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC54139
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat