Antibodies
Anti-IDO Antibody-Oligo Conjugate
SKU: aoc2397
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-IDO Antibody-IF1
Antibody Target
- Target
- Indoleamine 2,3-dioxygenase 1
- UniProt Number
- P14902
- Target Description
- Catalyzes the first and rate limiting step of the catabolism of the essential amino acid tryptophan along the kynurenine pathway (PubMed:17671174). Involved in the peripheral immune tolerance, contributing to maintain homeostasis by preventing autoimmunity or immunopathology that would result from uncontrolled and overreacting immune responses (PubMed:25691885). Tryptophan shortage inhibits T lymphocytes division and accumulation of tryptophan catabolites induces T-cell apoptosis and differentiation of regulatory T-cells (PubMed:25691885). Acts as a suppressor of anti-tumor immunity (PubMed:14502282, PubMed:23103127, PubMed:25157255, PubMed:25691885). Limits the growth of intracellular pathogens by depriving tryptophan (PubMed:25691885). Protects the fetus from maternal immune rejection (PubMed:25691885)..
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human